ID: 1082759320

View in Genome Browser
Species Human (GRCh38)
Location 11:57111624-57111646
Sequence CAAGAGGCACAGGTTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082759320_1082759325 20 Left 1082759320 11:57111624-57111646 CCAAGCTCAACCTGTGCCTCTTG No data
Right 1082759325 11:57111667-57111689 ATGACCCAGATCCCAGATGAAGG No data
1082759320_1082759323 -3 Left 1082759320 11:57111624-57111646 CCAAGCTCAACCTGTGCCTCTTG No data
Right 1082759323 11:57111644-57111666 TTGACAATTTATAATTAATCCGG No data
1082759320_1082759326 21 Left 1082759320 11:57111624-57111646 CCAAGCTCAACCTGTGCCTCTTG No data
Right 1082759326 11:57111668-57111690 TGACCCAGATCCCAGATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082759320 Original CRISPR CAAGAGGCACAGGTTGAGCT TGG (reversed) Intergenic
No off target data available for this crispr