ID: 1082759325

View in Genome Browser
Species Human (GRCh38)
Location 11:57111667-57111689
Sequence ATGACCCAGATCCCAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082759319_1082759325 24 Left 1082759319 11:57111620-57111642 CCAACCAAGCTCAACCTGTGCCT No data
Right 1082759325 11:57111667-57111689 ATGACCCAGATCCCAGATGAAGG No data
1082759320_1082759325 20 Left 1082759320 11:57111624-57111646 CCAAGCTCAACCTGTGCCTCTTG No data
Right 1082759325 11:57111667-57111689 ATGACCCAGATCCCAGATGAAGG No data
1082759322_1082759325 4 Left 1082759322 11:57111640-57111662 CCTCTTGACAATTTATAATTAAT No data
Right 1082759325 11:57111667-57111689 ATGACCCAGATCCCAGATGAAGG No data
1082759321_1082759325 10 Left 1082759321 11:57111634-57111656 CCTGTGCCTCTTGACAATTTATA No data
Right 1082759325 11:57111667-57111689 ATGACCCAGATCCCAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082759325 Original CRISPR ATGACCCAGATCCCAGATGA AGG Intergenic
No off target data available for this crispr