ID: 1082760013

View in Genome Browser
Species Human (GRCh38)
Location 11:57118407-57118429
Sequence CCAGAGACATGGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082760005_1082760013 24 Left 1082760005 11:57118360-57118382 CCATGGAATACTATGAAGCCATA 0: 274
1: 25430
2: 13946
3: 8130
4: 5409
Right 1082760013 11:57118407-57118429 CCAGAGACATGGATGGAGCTGGG No data
1082760007_1082760013 6 Left 1082760007 11:57118378-57118400 CCATAAAAAAGAATGAGGTCATG 0: 38
1: 2273
2: 11493
3: 21571
4: 12725
Right 1082760013 11:57118407-57118429 CCAGAGACATGGATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082760013 Original CRISPR CCAGAGACATGGATGGAGCT GGG Intergenic
No off target data available for this crispr