ID: 1082764404

View in Genome Browser
Species Human (GRCh38)
Location 11:57155844-57155866
Sequence CTTTCTCAGCTTGGTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082764404_1082764412 14 Left 1082764404 11:57155844-57155866 CCTGGAAAACCAAGCTGAGAAAG No data
Right 1082764412 11:57155881-57155903 CTATTGGCTGTTCCTGGGGATGG No data
1082764404_1082764414 27 Left 1082764404 11:57155844-57155866 CCTGGAAAACCAAGCTGAGAAAG No data
Right 1082764414 11:57155894-57155916 CTGGGGATGGCATCAGAACAAGG No data
1082764404_1082764411 10 Left 1082764404 11:57155844-57155866 CCTGGAAAACCAAGCTGAGAAAG No data
Right 1082764411 11:57155877-57155899 AAGGCTATTGGCTGTTCCTGGGG No data
1082764404_1082764406 -9 Left 1082764404 11:57155844-57155866 CCTGGAAAACCAAGCTGAGAAAG No data
Right 1082764406 11:57155858-57155880 CTGAGAAAGCCACAGTAGCAAGG No data
1082764404_1082764407 -2 Left 1082764404 11:57155844-57155866 CCTGGAAAACCAAGCTGAGAAAG No data
Right 1082764407 11:57155865-57155887 AGCCACAGTAGCAAGGCTATTGG No data
1082764404_1082764410 9 Left 1082764404 11:57155844-57155866 CCTGGAAAACCAAGCTGAGAAAG No data
Right 1082764410 11:57155876-57155898 CAAGGCTATTGGCTGTTCCTGGG No data
1082764404_1082764409 8 Left 1082764404 11:57155844-57155866 CCTGGAAAACCAAGCTGAGAAAG No data
Right 1082764409 11:57155875-57155897 GCAAGGCTATTGGCTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082764404 Original CRISPR CTTTCTCAGCTTGGTTTTCC AGG (reversed) Intergenic
No off target data available for this crispr