ID: 1082764405

View in Genome Browser
Species Human (GRCh38)
Location 11:57155853-57155875
Sequence CTACTGTGGCTTTCTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082764405_1082764412 5 Left 1082764405 11:57155853-57155875 CCAAGCTGAGAAAGCCACAGTAG No data
Right 1082764412 11:57155881-57155903 CTATTGGCTGTTCCTGGGGATGG No data
1082764405_1082764416 25 Left 1082764405 11:57155853-57155875 CCAAGCTGAGAAAGCCACAGTAG No data
Right 1082764416 11:57155901-57155923 TGGCATCAGAACAAGGTTGGTGG No data
1082764405_1082764410 0 Left 1082764405 11:57155853-57155875 CCAAGCTGAGAAAGCCACAGTAG No data
Right 1082764410 11:57155876-57155898 CAAGGCTATTGGCTGTTCCTGGG No data
1082764405_1082764414 18 Left 1082764405 11:57155853-57155875 CCAAGCTGAGAAAGCCACAGTAG No data
Right 1082764414 11:57155894-57155916 CTGGGGATGGCATCAGAACAAGG No data
1082764405_1082764411 1 Left 1082764405 11:57155853-57155875 CCAAGCTGAGAAAGCCACAGTAG No data
Right 1082764411 11:57155877-57155899 AAGGCTATTGGCTGTTCCTGGGG No data
1082764405_1082764409 -1 Left 1082764405 11:57155853-57155875 CCAAGCTGAGAAAGCCACAGTAG No data
Right 1082764409 11:57155875-57155897 GCAAGGCTATTGGCTGTTCCTGG No data
1082764405_1082764415 22 Left 1082764405 11:57155853-57155875 CCAAGCTGAGAAAGCCACAGTAG No data
Right 1082764415 11:57155898-57155920 GGATGGCATCAGAACAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082764405 Original CRISPR CTACTGTGGCTTTCTCAGCT TGG (reversed) Intergenic
No off target data available for this crispr