ID: 1082764409

View in Genome Browser
Species Human (GRCh38)
Location 11:57155875-57155897
Sequence GCAAGGCTATTGGCTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082764403_1082764409 19 Left 1082764403 11:57155833-57155855 CCTCAGAAAGGCCTGGAAAACCA No data
Right 1082764409 11:57155875-57155897 GCAAGGCTATTGGCTGTTCCTGG No data
1082764402_1082764409 20 Left 1082764402 11:57155832-57155854 CCCTCAGAAAGGCCTGGAAAACC No data
Right 1082764409 11:57155875-57155897 GCAAGGCTATTGGCTGTTCCTGG No data
1082764404_1082764409 8 Left 1082764404 11:57155844-57155866 CCTGGAAAACCAAGCTGAGAAAG No data
Right 1082764409 11:57155875-57155897 GCAAGGCTATTGGCTGTTCCTGG No data
1082764405_1082764409 -1 Left 1082764405 11:57155853-57155875 CCAAGCTGAGAAAGCCACAGTAG No data
Right 1082764409 11:57155875-57155897 GCAAGGCTATTGGCTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082764409 Original CRISPR GCAAGGCTATTGGCTGTTCC TGG Intergenic
No off target data available for this crispr