ID: 1082764414

View in Genome Browser
Species Human (GRCh38)
Location 11:57155894-57155916
Sequence CTGGGGATGGCATCAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082764408_1082764414 4 Left 1082764408 11:57155867-57155889 CCACAGTAGCAAGGCTATTGGCT No data
Right 1082764414 11:57155894-57155916 CTGGGGATGGCATCAGAACAAGG No data
1082764405_1082764414 18 Left 1082764405 11:57155853-57155875 CCAAGCTGAGAAAGCCACAGTAG No data
Right 1082764414 11:57155894-57155916 CTGGGGATGGCATCAGAACAAGG No data
1082764404_1082764414 27 Left 1082764404 11:57155844-57155866 CCTGGAAAACCAAGCTGAGAAAG No data
Right 1082764414 11:57155894-57155916 CTGGGGATGGCATCAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082764414 Original CRISPR CTGGGGATGGCATCAGAACA AGG Intergenic
No off target data available for this crispr