ID: 1082767690

View in Genome Browser
Species Human (GRCh38)
Location 11:57181991-57182013
Sequence CAGGCAACAGCAGTGCTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 427}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082767690_1082767694 -9 Left 1082767690 11:57181991-57182013 CCCTCCAGCACTGCTGTTGCCTG 0: 1
1: 0
2: 3
3: 62
4: 427
Right 1082767694 11:57182005-57182027 TGTTGCCTGCTGCCTAAGATGGG 0: 1
1: 0
2: 2
3: 8
4: 121
1082767690_1082767696 1 Left 1082767690 11:57181991-57182013 CCCTCCAGCACTGCTGTTGCCTG 0: 1
1: 0
2: 3
3: 62
4: 427
Right 1082767696 11:57182015-57182037 TGCCTAAGATGGGTGACACTTGG 0: 1
1: 0
2: 0
3: 13
4: 102
1082767690_1082767700 21 Left 1082767690 11:57181991-57182013 CCCTCCAGCACTGCTGTTGCCTG 0: 1
1: 0
2: 3
3: 62
4: 427
Right 1082767700 11:57182035-57182057 TGGGCCCAGCTTCCCTGGCCCGG 0: 1
1: 0
2: 7
3: 44
4: 437
1082767690_1082767701 22 Left 1082767690 11:57181991-57182013 CCCTCCAGCACTGCTGTTGCCTG 0: 1
1: 0
2: 3
3: 62
4: 427
Right 1082767701 11:57182036-57182058 GGGCCCAGCTTCCCTGGCCCGGG 0: 1
1: 0
2: 6
3: 62
4: 524
1082767690_1082767697 2 Left 1082767690 11:57181991-57182013 CCCTCCAGCACTGCTGTTGCCTG 0: 1
1: 0
2: 3
3: 62
4: 427
Right 1082767697 11:57182016-57182038 GCCTAAGATGGGTGACACTTGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1082767690_1082767693 -10 Left 1082767690 11:57181991-57182013 CCCTCCAGCACTGCTGTTGCCTG 0: 1
1: 0
2: 3
3: 62
4: 427
Right 1082767693 11:57182004-57182026 CTGTTGCCTGCTGCCTAAGATGG 0: 1
1: 0
2: 5
3: 14
4: 167
1082767690_1082767699 16 Left 1082767690 11:57181991-57182013 CCCTCCAGCACTGCTGTTGCCTG 0: 1
1: 0
2: 3
3: 62
4: 427
Right 1082767699 11:57182030-57182052 ACACTTGGGCCCAGCTTCCCTGG 0: 1
1: 0
2: 2
3: 35
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082767690 Original CRISPR CAGGCAACAGCAGTGCTGGA GGG (reversed) Exonic
900164734 1:1240151-1240173 CAAGCAACAGCAGCTCTGGCTGG + Intergenic
901000106 1:6144744-6144766 CAGGCCAGAGGAGTGCTGGAGGG + Intronic
901044277 1:6386121-6386143 CAGGCACCGGGAGAGCTGGAAGG + Intronic
901055312 1:6446415-6446437 CAGGCACTAGCAGGGCTGGGTGG + Intronic
901405352 1:9041396-9041418 CAGGCAGCAGCGTTGCTGGGAGG + Intronic
903453457 1:23470666-23470688 CAGGCCCCAGCAGTGCAGGAAGG - Intronic
903982588 1:27200323-27200345 CTGGAGGCAGCAGTGCTGGATGG - Intergenic
904245066 1:29181754-29181776 CCGGCAACGGCAGTGATGGCTGG + Exonic
904786295 1:32985503-32985525 CAGACAGCATCAGAGCTGGAAGG + Intergenic
904852355 1:33468542-33468564 CAGGCAAGACCAGGGCTGGATGG + Intergenic
905875762 1:41431275-41431297 CAGGCAGCGGCTGTGCTGAAGGG - Intergenic
906381064 1:45332469-45332491 CAGGCAACCGGTGTGGTGGATGG - Exonic
906703457 1:47876687-47876709 CAGCCTCCAGCAGTGCTGGGAGG + Intronic
907304570 1:53506574-53506596 GTGGCATCTGCAGTGCTGGATGG + Exonic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908387915 1:63659905-63659927 CACGCAGCAGCAATGCAGGAGGG - Exonic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910114763 1:83719596-83719618 CAGGGATTAGCAGTGATGGAGGG + Intergenic
910333731 1:86105137-86105159 CTGGCAGGAGCAGGGCTGGAAGG + Intronic
910825540 1:91404195-91404217 CAGGCACCAACAGGGCTGGCTGG + Intronic
911100713 1:94093975-94093997 CAGGGAACAGCAGGGCTGTTGGG - Intronic
911335514 1:96575647-96575669 CAGGCCACATCAGGACTGGATGG - Intergenic
912563794 1:110570439-110570461 CACAGAACAGCAGAGCTGGAAGG - Intergenic
912968299 1:114256732-114256754 CTAGCATCATCAGTGCTGGATGG + Intergenic
913084556 1:115424774-115424796 AAGGCCACAGCAGAGCAGGATGG - Intergenic
913531448 1:119737027-119737049 CAGGCAACAGGAAAGTTGGAGGG - Intronic
914425555 1:147572461-147572483 CAGGCTAGAGCTCTGCTGGATGG + Intronic
915150623 1:153828066-153828088 GAGACAACAGGACTGCTGGAAGG - Exonic
915687586 1:157650178-157650200 CAGTCAAAAGCACTGATGGATGG - Intergenic
916100314 1:161388683-161388705 AAGGCAAGGCCAGTGCTGGAAGG - Intergenic
916506586 1:165433674-165433696 CACGAAACATTAGTGCTGGAAGG - Intronic
917637499 1:176951129-176951151 AAGGCAGCTGGAGTGCTGGAAGG + Intronic
917788800 1:178486748-178486770 GAGGCCGCAGCAGGGCTGGAGGG + Intergenic
919541013 1:198845488-198845510 CAGGAGAAAGCAGTGCTGGCTGG + Intergenic
920160755 1:203996212-203996234 CAGCCAAAAGCGCTGCTGGATGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922620964 1:226987861-226987883 CTGGCATCAGCCGTGCTGGCAGG - Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922788767 1:228298031-228298053 CATGCATGAGCAGTGCTGGATGG + Intronic
922875318 1:228935842-228935864 CAGGCATGAGCAGGGCAGGAGGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
922899132 1:229122822-229122844 AAGGCAGCATCAGTGCTGGGAGG + Intergenic
923121721 1:230998370-230998392 GAGGCAACAGGAGTGGAGGATGG - Intronic
923384709 1:233454671-233454693 GAGGCAACAGCATTGCAAGAGGG - Intergenic
923543179 1:234904081-234904103 CAGGGAACATCACTGCTGGGTGG - Intergenic
1062817113 10:508876-508898 GTTCCAACAGCAGTGCTGGAAGG + Intronic
1064290799 10:14032560-14032582 CAGGCAGCAACAGTGAGGGAGGG - Intronic
1064777569 10:18795878-18795900 CAAGCCCCAGCAGAGCTGGAAGG - Intergenic
1065444796 10:25787232-25787254 CAGGCAGCAGAAGTGGTGAAAGG - Intergenic
1068439195 10:57030318-57030340 CAGGCAACTGCAGAGCTCCATGG - Intergenic
1068747991 10:60557033-60557055 CAGACGACAGCAGTGGGGGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069785578 10:70985947-70985969 CAGGCCAGAGCAGGGCTGGGTGG + Intergenic
1069990110 10:72309974-72309996 CAGGGAACAGCTGTGCTGGCAGG - Intergenic
1070986841 10:80696650-80696672 CAAGCACAAGCTGTGCTGGAGGG - Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1073516234 10:104077920-104077942 CAGCCACTAGAAGTGCTGGAGGG + Intronic
1075576608 10:123582329-123582351 CAGGCAACATCTGTGGTTGATGG - Intergenic
1075733302 10:124649028-124649050 CAGGCAACAGCAGCAGTGGAAGG + Intronic
1076266079 10:129110797-129110819 CAGTCAATAGAAGTGCTGGCCGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076880893 10:133238544-133238566 CAGGCACCGGCTGTGCTGGGGGG - Intronic
1077217473 11:1400945-1400967 CATGCACCAGCAGGGATGGAAGG - Intronic
1078753979 11:14191235-14191257 CTGGCCACGGCAGTGATGGAAGG + Intronic
1078867400 11:15310764-15310786 CAGTCACCATCAGTTCTGGAAGG + Intergenic
1079082075 11:17420636-17420658 CAGGCAACAGCATTGCAGCAGGG + Intronic
1079234564 11:18678880-18678902 CAGGCATAAGCAGGGCAGGAGGG + Intergenic
1079307968 11:19340992-19341014 AAGGGAAGAGCAGTGCAGGATGG - Intergenic
1079450479 11:20596945-20596967 CGGGCATCAGCAGGGCTTGAAGG - Intergenic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1080499181 11:32852403-32852425 CAGGCAGCAGGACTGCAGGAGGG + Intronic
1080749791 11:35141217-35141239 TAGCCAGGAGCAGTGCTGGATGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081664950 11:44911286-44911308 CCAGCACCAGCAGTGCTGGGAGG + Intronic
1082767690 11:57181991-57182013 CAGGCAACAGCAGTGCTGGAGGG - Exonic
1083227887 11:61295800-61295822 GAGGCAGCAGCAGATCTGGAAGG + Intergenic
1083603022 11:63960814-63960836 CAGGCCACCCCAGTGCTGGAGGG + Intergenic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084699798 11:70779029-70779051 CAGGCACCACCACTGCTGGGAGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085205642 11:74730683-74730705 CAGGCAGCACCTGTGCCGGAGGG - Intronic
1086058305 11:82674398-82674420 CAGGCAACAGAAGTGATGGATGG + Intergenic
1086869069 11:92015254-92015276 CAGGCAGCAGCGAGGCTGGAGGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1090438056 11:126703170-126703192 CAGGAAGCAGCACGGCTGGAAGG - Intronic
1090854861 11:130602404-130602426 CAGGCATGAGGGGTGCTGGAGGG + Intergenic
1092470438 12:8773629-8773651 TTGTCAACAGCAGTGCTGGCTGG - Exonic
1094474736 12:30832525-30832547 CAGGCAACACCACTTCTGAAGGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1100112224 12:91259678-91259700 CAGGCAACAGCTGAGGTAGAGGG - Intergenic
1102224179 12:111216357-111216379 CAGGAAACATTAGTTCTGGATGG - Intronic
1102960636 12:117091180-117091202 CAGGCAACAGGAAGGCTGGCAGG + Intronic
1103108847 12:118256297-118256319 CAGCTACCAGCAGTGTTGGAGGG - Intronic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1103316677 12:120061835-120061857 CCCGACACAGCAGTGCTGGAAGG + Intronic
1103645585 12:122389851-122389873 CTGTCAACACCAGTGCTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105254194 13:18729898-18729920 CCTGTAACAGCAGTGCTTGAGGG - Intergenic
1105547365 13:21360601-21360623 GAGGCATCAGCAGGGCTGGCTGG + Intergenic
1107068383 13:36242729-36242751 CAAGCACAAGCAGTGCTGGAGGG + Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108596010 13:51950200-51950222 CAGGTCACATGAGTGCTGGATGG - Intronic
1108775693 13:53762233-53762255 CAGGAAGCTGCTGTGCTGGAGGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109339713 13:61040313-61040335 CAGGCAGCAGCAATGCCAGATGG - Intergenic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112733982 13:102397300-102397322 AAGGCAAAAGCAGAGCTGAAAGG + Intronic
1112809962 13:103206867-103206889 CAGGCACCAGCAGGACTGGAAGG - Intergenic
1113952317 13:114078949-114078971 CAGGGAGGAGCAGTGCTGGGTGG - Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1116276334 14:42838636-42838658 CAGGCACAAGCAGGGCAGGAGGG + Intergenic
1116870362 14:50064132-50064154 CAGCTACCAGGAGTGCTGGAGGG + Intergenic
1118437009 14:65780642-65780664 CAGGGCAAAGCAGTGGTGGAAGG + Intergenic
1118471913 14:66082199-66082221 AAGCCACCAGCAGTCCTGGAGGG - Intergenic
1118947948 14:70406145-70406167 CAGGCATAAGCAGGGCAGGAGGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1121828065 14:97027006-97027028 ATGGCAACAGCTGTCCTGGATGG + Intergenic
1123010476 14:105347298-105347320 CAGGCAACGGGAGCACTGGATGG - Intronic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124457802 15:29860272-29860294 CAGGGAACAGGAGTGCAGAAGGG - Intronic
1125255620 15:37759651-37759673 CAGGGAACAGCAGTGGATGATGG + Intergenic
1125421956 15:39512798-39512820 CAGGGAACAGCAGAGCAGGGAGG + Intergenic
1125575099 15:40749877-40749899 CAGGCAACAGCAGTCCCCCATGG + Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1127821137 15:62657162-62657184 GAAGCAACAGCAGTGATGGATGG + Intronic
1128527622 15:68423232-68423254 CAGGCAACTGGAATGCTGTATGG + Intronic
1128548573 15:68583517-68583539 CAGGCACCAGCAGGACAGGAAGG - Intronic
1128947325 15:71836360-71836382 CTGGCAAAAGAAGTGCTGGAAGG + Intronic
1129462987 15:75709322-75709344 GAGGCAAGAGGAGAGCTGGATGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130810214 15:87368688-87368710 TAAGCACCAGCTGTGCTGGAGGG - Intergenic
1131214940 15:90529334-90529356 AAGGCTGCAGCAGGGCTGGATGG + Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132295719 15:100732786-100732808 CAGGACACAGCACTGCAGGAGGG + Intergenic
1132672364 16:1107057-1107079 CAGGCCACATCAGTCCCGGAAGG - Intergenic
1132753513 16:1470595-1470617 CACTGAACAGCAATGCTGGAGGG + Intronic
1136056696 16:27695136-27695158 GAGGCAACAGCGGTGGAGGAGGG - Intronic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1137342365 16:47621166-47621188 CCAGCAACAGAAGCGCTGGAAGG - Intronic
1137624225 16:49897472-49897494 CAGGAAAGAGCAGGGCAGGAAGG - Intergenic
1137937030 16:52644669-52644691 CTGGTAACAGAAGTGCTGAAGGG + Intergenic
1138095063 16:54205066-54205088 CAAGCAACAGGGGTGCTGGGGGG + Intergenic
1138221038 16:55250665-55250687 CTGGTGGCAGCAGTGCTGGAAGG + Intergenic
1139280211 16:65764164-65764186 CAGGCAGAAGGAGTGATGGATGG + Intergenic
1139510228 16:67423861-67423883 TATGCAACAGAACTGCTGGAGGG + Intergenic
1139589940 16:67927986-67928008 AAGGGAACTGCAGTGCTGGGTGG + Exonic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1142767091 17:2071001-2071023 CTGGCAACAGAAGAGCTAGACGG - Intronic
1143856338 17:9853369-9853391 CAGGGAACAGCTGTGCAGGACGG + Intronic
1144766599 17:17736365-17736387 AAGTCAAGAGCAGTGCTGGCAGG - Intronic
1145030794 17:19503563-19503585 TGGGCAACAGCAGAGCTGGGAGG + Intronic
1146280990 17:31544385-31544407 GAGGCATCAGCTGAGCTGGAAGG + Intergenic
1146459849 17:33037435-33037457 CCAGCCACAGCAGGGCTGGAGGG - Intronic
1148523632 17:48307577-48307599 CAGGCAACATCAGATCTGAATGG - Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1148868018 17:50639232-50639254 CAAGCAAACCCAGTGCTGGATGG + Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150613156 17:66749491-66749513 CAGGAGTCAGCAGTCCTGGATGG - Intronic
1150834692 17:68553537-68553559 CAGGTCACAGCACTCCTGGAGGG + Intronic
1151398127 17:73838527-73838549 GAGGCTTCAGCACTGCTGGAAGG + Intergenic
1151464046 17:74273120-74273142 CAGGCACCAGTAGCTCTGGACGG + Intergenic
1151472236 17:74325709-74325731 CAGGTAACAGAGGTGCTGGGCGG + Intergenic
1152639292 17:81442981-81443003 CAGGCACCAGCAGCACTTGATGG + Exonic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154497941 18:14975969-14975991 GAGGGGACAGCAGGGCTGGAGGG - Intergenic
1155084911 18:22448599-22448621 CATGCAACAGCAGGGATGGTGGG + Intergenic
1156339349 18:36197194-36197216 AAGGCATCAGCAGTGGTGGTGGG + Intronic
1156360829 18:36383130-36383152 CAGAACACAGCAGGGCTGGAAGG - Intronic
1156367313 18:36440930-36440952 AAGGCAATAGCAGGGCAGGAGGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157371222 18:47113987-47114009 GATGCAACAGCTGTGCTGCATGG - Intronic
1157600657 18:48891152-48891174 CAAGAGACAGCAGAGCTGGAAGG - Intergenic
1157991489 18:52502069-52502091 CATGCAAATGCAGAGCTGGAAGG - Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158382975 18:56955957-56955979 CAGGCATCAGCAATCCTGCAAGG - Intronic
1160778764 19:868659-868681 CAGGGAGCAGCATTGCTGGGGGG - Intronic
1161410719 19:4115722-4115744 CAGGTGGCAGCAGTGCTTGAGGG - Intronic
1161652958 19:5496510-5496532 GAGGGAACGGCAGTGCTGCATGG - Intergenic
1162284713 19:9729573-9729595 CAGGCAGCAGCAGTACTAGTAGG - Intergenic
1162687333 19:12399142-12399164 CAGGAATCAGCAGTGCTGACTGG + Intronic
1162691648 19:12438973-12438995 CAGGAATCAGCAGTGCTGACTGG + Intronic
1163407111 19:17129622-17129644 GAGGAAACAGAAGTGCTGAAAGG - Intronic
1163578446 19:18123936-18123958 CAGGCCACAGCACAGATGGAGGG + Exonic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164431718 19:28194520-28194542 CAGGCAAGAACTGTGCTGCAGGG - Intergenic
1164557686 19:29266277-29266299 CTGGCAACAGCAGCAGTGGAGGG - Intergenic
1164885731 19:31777031-31777053 CAGGTAACACCAGTGCTGGCTGG + Intergenic
1165224656 19:34346079-34346101 TAGGCAAAATCAGTGCGGGATGG + Intronic
1165666289 19:37631395-37631417 CAGGAAACACTAGTGCTTGATGG - Exonic
1166209232 19:41295168-41295190 ATGCCAACAGCAGTGCTGTAAGG + Intronic
1166747354 19:45147655-45147677 CAGGCTCCTGCAGTGCTGGCTGG - Intronic
1167086127 19:47310840-47310862 CAGGCAGGAGCAGAGATGGATGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168244763 19:55106682-55106704 CAAGCAGCAGCTGTGCTGCAGGG - Intronic
1168292320 19:55362639-55362661 CAGGCAACACCAGGCCTGGCAGG + Exonic
925017162 2:538894-538916 TAAGCAACTGCTGTGCTGGAGGG - Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925083690 2:1091166-1091188 CTGGCAAGAGCAGTGCTGCCAGG + Intronic
925314862 2:2913801-2913823 CAGGCAACAAAAGTGCAGGTGGG + Intergenic
925741400 2:7008556-7008578 GAGGCAGCAGCAGTGCTGAGTGG - Intronic
927038398 2:19204079-19204101 CAGGCAAGAGCAGGCCTGCATGG + Intergenic
927638831 2:24834319-24834341 CAGGCCCCAGGAGTGCTAGACGG - Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930051621 2:47220332-47220354 CTCCCCACAGCAGTGCTGGAGGG + Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934677570 2:96260494-96260516 CAGGCCAGAGCACAGCTGGAAGG - Intronic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936096587 2:109534927-109534949 CACTCACAAGCAGTGCTGGAGGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937357354 2:121206414-121206436 GAGGCAAGAGGATTGCTGGAAGG - Intergenic
937913490 2:127087615-127087637 CAGCCAAGGGCAGTGCAGGACGG + Intronic
938576816 2:132612060-132612082 CAGGGCACTGCAATGCTGGATGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
942057912 2:172202193-172202215 CAACCAATAGCTGTGCTGGAAGG + Intergenic
943507047 2:188774319-188774341 ACAGCAAAAGCAGTGCTGGAAGG + Intronic
944531416 2:200671349-200671371 TAGGCAAAAGAATTGCTGGATGG + Exonic
944650398 2:201824522-201824544 CAAGCAACAGCAATGCAAGATGG + Intronic
945448899 2:209970913-209970935 CGGACAACAGCTGTGCTGAAGGG - Exonic
946124736 2:217552744-217552766 GAGGGAATAGCAGAGCTGGAGGG + Intronic
947654059 2:231811051-231811073 CAGGAAACTGCAGAGCTTGAAGG - Intergenic
947966354 2:234284883-234284905 CAAACAGCAGCAGTGATGGAAGG - Intergenic
948029408 2:234804797-234804819 CAGGAAACAGAGGTGCAGGAGGG + Intergenic
948408974 2:237744325-237744347 CAGGCAACACCAGACTTGGATGG - Intronic
948433902 2:237939221-237939243 CATGCAACAACTTTGCTGGAGGG + Intergenic
948725854 2:239933453-239933475 CAGCCTACAGCAGTGGTGGCAGG - Intronic
949036655 2:241818621-241818643 CAGGCAGCAGCCGTCCTGGCAGG - Intergenic
1168834912 20:871602-871624 GAGGCAGCATCACTGCTGGATGG + Exonic
1169159249 20:3362321-3362343 CAAGCGACAGCAGTGCAAGATGG - Intronic
1169395438 20:5224892-5224914 CATACAACGTCAGTGCTGGAAGG + Intergenic
1171343907 20:24451523-24451545 CAGGCAGCAGCAGTGGTGAATGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173181882 20:40812265-40812287 CAGGCCACAGCATCCCTGGAGGG + Intergenic
1173225862 20:41162101-41162123 CAGGCCTCAGCAGTGCCGGTAGG + Intronic
1173924524 20:46770985-46771007 GAGTCAGCAGAAGTGCTGGAAGG + Intergenic
1173959590 20:47060731-47060753 CAAGCAACACCAGTGAGGGAAGG - Intronic
1175304503 20:57966579-57966601 CTGGCAACCCCAGTGCTGCACGG - Intergenic
1175657449 20:60783766-60783788 CAGGAAACAGCTGTGAAGGAAGG - Intergenic
1175925384 20:62468815-62468837 CAGGCCCCAGCAGAGCTGGGAGG + Intronic
1176019293 20:62954315-62954337 CAGGCGAGAACAGAGCTGGAGGG + Intronic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178350771 21:31872193-31872215 CATGCAACATCAGAGCTGAAAGG - Intergenic
1178781608 21:35608743-35608765 CATGCAAGAGCATGGCTGGAAGG - Intronic
1178830364 21:36051222-36051244 TTGTCAACAGCAGTGCTGGCTGG - Intronic
1179183329 21:39063107-39063129 CAGGCAGCAGGGCTGCTGGATGG + Intergenic
1179306896 21:40162357-40162379 CAGGAAATACTAGTGCTGGAAGG + Intronic
1179786753 21:43734612-43734634 CTGTTAACAGCAGTGCTGCAGGG + Intronic
1179928160 21:44550012-44550034 CAGGCCCCAGCTGTGCTGGGAGG - Intronic
1179939523 21:44628702-44628724 CAGGCCCCAGCTGTGCTGGGAGG + Intronic
1180247003 21:46555024-46555046 GAGGCAAGAGCAGTCCTGGCAGG + Intronic
1181234968 22:21443211-21443233 CAGCCCACAGCAGTTCAGGAGGG - Intronic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1183704148 22:39466603-39466625 CTGGCAGCAGCTGGGCTGGAAGG - Intronic
1184075732 22:42176354-42176376 CAAGCAACTGCTGCGCTGGAAGG + Intronic
1184503004 22:44885300-44885322 CTGGCCTCAGCAGTGCAGGAAGG - Intronic
1184601569 22:45546884-45546906 CAGGCAGGAGCAGGGATGGAGGG + Intronic
1184977673 22:48074502-48074524 CAGATAACAGGAGGGCTGGAAGG + Intergenic
1184984967 22:48125221-48125243 CAGGCAATAGCAGGTCTTGAGGG + Intergenic
1185011339 22:48316360-48316382 CCGGCAGCTGCAGTGCTGTAAGG - Intergenic
949360318 3:3224912-3224934 CAGGGAACAACAGAGCTTGATGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950335362 3:12188800-12188822 CAGGAAACAGCTGGGCTGAAGGG - Intronic
950348023 3:12316828-12316850 CAGGAAACAGTAGAGCTGGGTGG + Intronic
950965438 3:17142738-17142760 GAGCCCACAGCAGGGCTGGACGG - Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
953031528 3:39183098-39183120 CTAGCAACAGCAGTGTGGGAAGG - Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
954541285 3:51394482-51394504 CATGCAGCAGTGGTGCTGGAAGG - Exonic
955083561 3:55680010-55680032 CAAATAAAAGCAGTGCTGGATGG - Intronic
956580042 3:70800457-70800479 CAGGGAAGAGCAGTGCAGGTAGG - Intergenic
956775797 3:72564535-72564557 CAGGCTAAAGCAGTGAAGGAAGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
958825608 3:99026687-99026709 GAAGCATCAGGAGTGCTGGAAGG + Intergenic
959029709 3:101284059-101284081 CAGGCAACAGAATTTCTTGATGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961048509 3:123726234-123726256 CAGGCAGCACCAGTGATGTAGGG + Intronic
961183794 3:124897192-124897214 CTGTCAACAGTAGTTCTGGAAGG - Intronic
962024179 3:131529604-131529626 AAGGACACATCAGTGCTGGAGGG + Intergenic
962843924 3:139259009-139259031 CAGGGAACAGCAGAGCTGGAAGG - Intronic
963063219 3:141241681-141241703 CATGGCACAGCAGTGTTGGACGG - Intronic
963315967 3:143759182-143759204 CAGGAAATAGCAGTGTTAGATGG - Intronic
963414385 3:144976107-144976129 AAGGAAACAGAAGTGCTTGAAGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965310799 3:167125787-167125809 CAGAAAGCAGCAGTGCTGGTAGG + Intergenic
968520679 4:1033450-1033472 CAGGCAGCAGCAGCTGTGGAGGG + Intergenic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969449467 4:7264822-7264844 CAGCCAGCAGCAGGGCTGCACGG - Intronic
969531573 4:7733606-7733628 CAGGTAAGAGCAGTGCTCCATGG - Intronic
969534453 4:7747284-7747306 CAGGCAAGAGCAGGGAAGGAAGG + Intergenic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
973534200 4:51864806-51864828 CAGGCCATAGCAGTGCTTGTTGG + Intronic
973877700 4:55237064-55237086 CAGGCAAAAGCAGTTCTGAGAGG - Intergenic
974121105 4:57640209-57640231 CAGTGAGCAGCAGTGCGGGATGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975109698 4:70609695-70609717 CAGGCTCCAGCAGGTCTGGAGGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976454520 4:85230155-85230177 CAGCCATGAGCAGTGCTGGTTGG + Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977582940 4:98744931-98744953 CAGGAATCAGAAGTGCTGGCAGG - Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979021611 4:115506930-115506952 GAAGCAAAAGCAGTGCTGAAAGG + Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980763762 4:137271057-137271079 CAGGATACAGAAGTTCTGGAGGG - Intergenic
981310213 4:143290510-143290532 CAGGCAACAGCTGTACTACAGGG + Intergenic
982771472 4:159400943-159400965 CAGCCAGCAGCAGTTCTGCAGGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985350731 4:189058645-189058667 CAGACAACAGCGGTGGTGGACGG - Intergenic
986027429 5:3864135-3864157 CTGGGAACAGCATTTCTGGAAGG - Intergenic
986549476 5:8936384-8936406 CAAGCATCTGCTGTGCTGGAGGG - Intergenic
987572932 5:19688000-19688022 CAGGTGCCAGCAGTGGTGGATGG - Intronic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988872775 5:35409364-35409386 CATGCAGCAGCAGTGTTGGGAGG - Intergenic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
995187265 5:109285033-109285055 CAGCAAAAAGCAGTGCTAGAAGG + Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996404071 5:123089741-123089763 CGGGCCCCAGCATTGCTGGATGG + Intronic
1000187014 5:158869041-158869063 CAGAAAACACCAGTCCTGGACGG - Intronic
1002199226 5:177517697-177517719 CAGGCAACAGCATTGCGGCAAGG + Intergenic
1002199319 5:177518420-177518442 TAGGCAACAGCATTGCGGCAAGG + Intergenic
1002568907 5:180129068-180129090 CAGACAACAGCACAGCTGGTCGG - Intronic
1002583984 5:180229785-180229807 CAGGCAACAGGAGAGCTGCCTGG + Intergenic
1002913087 6:1506023-1506045 CAGGCAAGAGAAGAGCTGGGTGG - Intergenic
1002916110 6:1529113-1529135 AAGACAACATCAGTGCTGGCGGG - Intergenic
1003404317 6:5816096-5816118 GAGGCATCAGCAGGGCTGGCTGG - Intergenic
1003464256 6:6363325-6363347 CTGACCACAGCAGTGCTGGTTGG - Intergenic
1004047137 6:12037113-12037135 CAGTCAGGAGCAGTGATGGAGGG + Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004513669 6:16303433-16303455 CTGGCCAGAGCAGGGCTGGAGGG - Exonic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006185802 6:32181149-32181171 CAGGCGAGAGTAGTACTGGAGGG - Exonic
1006506036 6:34489419-34489441 CATCCAGCAGCAGTGCTGGGTGG + Intronic
1006511123 6:34521709-34521731 CAGGCAACGGCGGTGGTGGATGG + Intronic
1006739248 6:36295444-36295466 CAGGTAAGGGCAGTGTTGGAGGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009519551 6:64664074-64664096 CAGGGATCAGTAGTGGTGGACGG + Intronic
1009673581 6:66788124-66788146 CTGGCAGCAGCAGTGATGGCGGG - Intergenic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009955487 6:70447876-70447898 CAGGCAACAGCAGTACTGAGTGG - Intronic
1010395987 6:75392642-75392664 CAGGCAATAACAGTGCTGGTGGG - Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1012177722 6:96109855-96109877 CAGGCAGCAGCAGGTCTTGATGG - Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013362090 6:109403415-109403437 CAGTAAACAGCACTGCTGAAGGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014768465 6:125434307-125434329 CAGGCATGAGCAGGGCAGGAGGG - Intergenic
1015044602 6:128762349-128762371 CTGGCAACAGCGGTGCAGCAAGG - Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1018101888 6:160447387-160447409 AGGGAAACAGAAGTGCTGGAGGG - Intronic
1018133767 6:160757822-160757844 AGGGAAACAGAAGTGCTGGAGGG + Intergenic
1018689420 6:166332982-166333004 CAGGAGACAGCACAGCTGGAAGG + Intronic
1018714429 6:166521015-166521037 CCAGGGACAGCAGTGCTGGAGGG - Intronic
1019324246 7:430197-430219 CAGGCCTCAGCGGGGCTGGAGGG + Intergenic
1019329098 7:453982-454004 CAGGGAACAGCAATGCCGGCCGG - Intergenic
1019488063 7:1298541-1298563 CAGGCTCCTGCAGTGCTGGAAGG + Intergenic
1019695934 7:2446170-2446192 GAGCCAGCAGCAGGGCTGGAAGG + Intergenic
1020768720 7:12359200-12359222 CACACAACAGTAGTACTGGAAGG + Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021858139 7:24878182-24878204 GTGGAAACAGCTGTGCTGGAGGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022265614 7:28751288-28751310 AAGGCCACAGCTCTGCTGGAAGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1025260687 7:57415673-57415695 CATGAAATAGCAGTTCTGGAAGG + Intergenic
1026896492 7:74012881-74012903 CAGGCAGCTGGAGTGCAGGAGGG + Intergenic
1026897612 7:74019361-74019383 CAGGCAGAAGCAGTGCCAGATGG - Intergenic
1027505933 7:79017005-79017027 CTTGCAACAGCAGTGTTGGCAGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030041679 7:105456896-105456918 CAGGCATGAGCTGTGCTGGCCGG - Exonic
1030113786 7:106048271-106048293 AAGGCAACAGCAGGCTTGGAAGG + Intergenic
1030407799 7:109136651-109136673 CAGGCAATAACAATGCTGGTGGG - Intergenic
1030564663 7:111138387-111138409 CAGGAAATGCCAGTGCTGGAGGG - Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032551070 7:132785142-132785164 CTGGAGGCAGCAGTGCTGGATGG - Exonic
1032725108 7:134583880-134583902 CAACCAACAAAAGTGCTGGAAGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034876988 7:154733214-154733236 CCAGCAGCAGCAGTTCTGGAAGG - Intronic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035594952 8:849599-849621 CAGGCTACAGGGGTCCTGGAAGG - Intergenic
1035954777 8:4064671-4064693 AGGGCAGCAGCAGTGTTGGAGGG - Intronic
1036217491 8:6892832-6892854 CAGGCAAAAGGAGTGGTGCAGGG + Intergenic
1037745146 8:21637473-21637495 CAGGTAACTGCAGTGCCAGAGGG - Intergenic
1039402054 8:37278256-37278278 AAGGCAAGAGCATTGCTTGAGGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040315675 8:46259635-46259657 CAGGCAAAAACGGTGCTGCAGGG + Intergenic
1040387254 8:46921862-46921884 CAGGCAACAGCAGCCCTTCATGG + Intergenic
1041144061 8:54853325-54853347 CAGGAAGCAGCAGTGAAGGAAGG + Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045534694 8:103016663-103016685 CAGAGAACAGCTGTGCAGGATGG - Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047732353 8:127737650-127737672 CTGGCAAAAGGAGTGTTGGACGG + Intronic
1047995280 8:130329162-130329184 GAGGCAGCAGCAGTGGTTGAGGG - Intronic
1048307104 8:133292163-133292185 CAGGCATGAGCTGCGCTGGATGG + Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049228909 8:141472089-141472111 CAGGAGGCAGAAGTGCTGGAAGG - Intergenic
1050008356 9:1158623-1158645 CAGGCACAAGCACTGCTGAAGGG + Intergenic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1055085905 9:72314132-72314154 CAGACCATAGCAGTGCTAGATGG + Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056030411 9:82547522-82547544 CTGGCCACAGCTGGGCTGGATGG + Intergenic
1056338483 9:85601245-85601267 AGGGCAGCAGCAGTGCTGGTGGG - Intronic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1056711676 9:88996734-88996756 CAGGCACCAGCAGGCCTGGGAGG - Exonic
1056837493 9:89968705-89968727 CATGCACCAGCAGTGCATGAGGG + Intergenic
1057933051 9:99212549-99212571 CACGCAACAGCATTGCTCAAGGG - Intergenic
1060929210 9:127478238-127478260 CAGGCAACGGGAGTGCAGGGTGG - Intronic
1061043664 9:128153218-128153240 AAGACAGCAGCAGTGCTGGGGGG - Intronic
1061620629 9:131809341-131809363 CAGGCACCAGCAGTGGTGCTGGG - Intergenic
1061623227 9:131825028-131825050 CAGGCAGGAGCAGTTCTGGGGGG - Intergenic
1062598911 9:137311447-137311469 GAGGCTGCAGCAGTGCGGGATGG + Intronic
1186826009 X:13340679-13340701 CAAGGAGGAGCAGTGCTGGATGG - Intergenic
1187628376 X:21141919-21141941 CTGGCAGGGGCAGTGCTGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1190640681 X:52481117-52481139 CATAAAACAGCAGTTCTGGAAGG - Intergenic
1190646991 X:52531748-52531770 CATAAAACAGCAGTTCTGGAAGG + Intergenic
1190856140 X:54296798-54296820 CAGGCAGCTGCAGTGCTGATGGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191604243 X:63044076-63044098 CTAGAAACAGCAGAGCTGGAAGG + Intergenic
1191612055 X:63127511-63127533 CATCCCACAGCAGTGCTGTATGG + Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1194148310 X:90289964-90289986 CAGGCAACAGCGTTGCAAGATGG - Intergenic
1194796564 X:98218470-98218492 AAGGCAACAACAGTGTGGGATGG - Intergenic
1194930315 X:99880312-99880334 GAGGCAACAGCTGTGGTAGAAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198711077 X:139505046-139505068 CAGGCACAAGAAGTGATGGAGGG - Intergenic
1198996374 X:142578438-142578460 CAGGCCACAGGTGTGCTGCAGGG + Intergenic
1200494689 Y:3866733-3866755 CAGGCAACAGCGTTGCAAGATGG - Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic