ID: 1082768156

View in Genome Browser
Species Human (GRCh38)
Location 11:57184780-57184802
Sequence CAGGATGCAGGGTGGGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 439}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082768156_1082768163 -6 Left 1082768156 11:57184780-57184802 CCACGTTCCCACCCTGCATCCTG 0: 1
1: 0
2: 1
3: 36
4: 439
Right 1082768163 11:57184797-57184819 ATCCTGTGTGGTCCCACCAAGGG 0: 1
1: 0
2: 1
3: 9
4: 92
1082768156_1082768165 2 Left 1082768156 11:57184780-57184802 CCACGTTCCCACCCTGCATCCTG 0: 1
1: 0
2: 1
3: 36
4: 439
Right 1082768165 11:57184805-57184827 TGGTCCCACCAAGGGCTGTCAGG 0: 1
1: 0
2: 0
3: 17
4: 147
1082768156_1082768175 29 Left 1082768156 11:57184780-57184802 CCACGTTCCCACCCTGCATCCTG 0: 1
1: 0
2: 1
3: 36
4: 439
Right 1082768175 11:57184832-57184854 CCTCTGGCTGGTCCATATGAGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1082768156_1082768171 13 Left 1082768156 11:57184780-57184802 CCACGTTCCCACCCTGCATCCTG 0: 1
1: 0
2: 1
3: 36
4: 439
Right 1082768171 11:57184816-57184838 AGGGCTGTCAGGGGCTCCTCTGG 0: 1
1: 0
2: 3
3: 25
4: 248
1082768156_1082768172 17 Left 1082768156 11:57184780-57184802 CCACGTTCCCACCCTGCATCCTG 0: 1
1: 0
2: 1
3: 36
4: 439
Right 1082768172 11:57184820-57184842 CTGTCAGGGGCTCCTCTGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 471
1082768156_1082768166 3 Left 1082768156 11:57184780-57184802 CCACGTTCCCACCCTGCATCCTG 0: 1
1: 0
2: 1
3: 36
4: 439
Right 1082768166 11:57184806-57184828 GGTCCCACCAAGGGCTGTCAGGG 0: 1
1: 0
2: 1
3: 14
4: 127
1082768156_1082768173 28 Left 1082768156 11:57184780-57184802 CCACGTTCCCACCCTGCATCCTG 0: 1
1: 0
2: 1
3: 36
4: 439
Right 1082768173 11:57184831-57184853 TCCTCTGGCTGGTCCATATGAGG 0: 1
1: 0
2: 0
3: 8
4: 119
1082768156_1082768167 4 Left 1082768156 11:57184780-57184802 CCACGTTCCCACCCTGCATCCTG 0: 1
1: 0
2: 1
3: 36
4: 439
Right 1082768167 11:57184807-57184829 GTCCCACCAAGGGCTGTCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 178
1082768156_1082768162 -7 Left 1082768156 11:57184780-57184802 CCACGTTCCCACCCTGCATCCTG 0: 1
1: 0
2: 1
3: 36
4: 439
Right 1082768162 11:57184796-57184818 CATCCTGTGTGGTCCCACCAAGG 0: 1
1: 0
2: 1
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082768156 Original CRISPR CAGGATGCAGGGTGGGAACG TGG (reversed) Intronic
900552064 1:3261783-3261805 CAGGATGGAGGGTGGGGACCAGG - Intronic
900586587 1:3435408-3435430 CAGGATTCATGGGGGGGACGGGG - Exonic
901192306 1:7419936-7419958 CAGGATGGAGGGCGGGATGGTGG - Intronic
901207800 1:7507378-7507400 CAGGCTGCAGGCTGGGGAGGGGG + Intronic
901528870 1:9841441-9841463 CAGGGTCCAGGGTGGGGACCAGG + Intergenic
902083062 1:13834387-13834409 CAGGATGCTGGGTGGAAGTGGGG + Intergenic
902208995 1:14891305-14891327 CAGGGTAAAGGGTGGGAAGGGGG - Intronic
902514950 1:16985103-16985125 CAGGATGCTGGGGTGGGACGGGG + Intergenic
902623350 1:17663029-17663051 CAGGGTGCCAGGTGGGAAAGGGG - Intronic
902723939 1:18322936-18322958 AAAGATGGAGGGTGGGAATGGGG + Intronic
902740864 1:18437049-18437071 CAGGAATCAGGGTGGCATCGAGG - Intergenic
903363486 1:22792115-22792137 CTGAAAGCAGGGTGGGAAGGAGG - Intronic
903364494 1:22797640-22797662 GAGGAGGCAGGGTGGGAGCAGGG - Intronic
904253389 1:29239710-29239732 CAGGATGCAGGAGGGCAACTAGG - Intronic
904611607 1:31728929-31728951 AAGGATGCAGGGTGGGCTCTAGG - Intronic
904616366 1:31752397-31752419 GAGGAGGCAGGGTGGGGGCGGGG - Intronic
904779759 1:32936921-32936943 CAGGCTGCAGTATGGGAGCGGGG + Exonic
905211622 1:36378253-36378275 CAGGATGGAGGAAGGGAACATGG + Intronic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905490619 1:38340675-38340697 CAGGATGGGTGGTGGGAACGTGG + Intergenic
905656472 1:39689271-39689293 CAGAAGGCAGGGTGGGAACCAGG - Intronic
906087469 1:43148150-43148172 CGGGTTGCGGGGTGGGAACGCGG + Intronic
906117091 1:43364264-43364286 CAGGATCCAGGCTAGGAATGTGG + Intronic
906189567 1:43887890-43887912 CAGGTTTCAAGGTGGGAACAAGG - Intronic
906911792 1:49960014-49960036 GAGGGTGAAGGGTGGGAGCGGGG + Intronic
909657160 1:78045005-78045027 CAAGGAGCAGGGTGGGGACGGGG + Intronic
909706919 1:78596517-78596539 CAGGAGGCAGAGTGGGAAGAGGG - Intergenic
912437111 1:109669389-109669411 CAAGATGCGGGGAGGGACCGTGG + Intronic
912812379 1:112803957-112803979 TAGGATGCAGGGTGGGGGAGAGG - Intergenic
912887838 1:113494355-113494377 GAGGATGAAGGGTGGGAAGAGGG + Intronic
914214077 1:145608380-145608402 ATGGATGCCGGGTGGGGACGCGG - Intronic
914466022 1:147928783-147928805 ATGGATGCCGGGTGGGGACGCGG - Intronic
914883270 1:151564379-151564401 CAGGATGGAGGGAGGGACCTTGG - Intronic
917104650 1:171480281-171480303 CAGGAAGAAGGGAGGGAAAGAGG - Intergenic
917210975 1:172631847-172631869 CAGCATTCAGGGGGGAAACGAGG - Intergenic
917405506 1:174702204-174702226 CACCATGCAGAGTGGGAACTTGG - Exonic
917664114 1:177207353-177207375 AATCATGCAGGGTGGGAAGGAGG + Intronic
917920267 1:179744359-179744381 CAGAAGGCAGTGTGGGGACGAGG + Intronic
917976950 1:180245854-180245876 CAGGACACGGGGTGGGAATGTGG - Intronic
918313684 1:183305033-183305055 AAGGATGCGGGATGGGAATGGGG - Intronic
919986759 1:202681094-202681116 CAGGAGCCAGGGTGGGACCAGGG - Intronic
920164927 1:204029087-204029109 AAGGAAGCAGACTGGGAACGGGG + Intergenic
923645629 1:235817711-235817733 CAGGATGGAGGGTGGGAGAAGGG + Intronic
1062934359 10:1374954-1374976 CAGGAGGCAGGCTGGGGCCGGGG + Intronic
1063289943 10:4735037-4735059 AAGGAGGCAGGGAGGGAAGGAGG - Intergenic
1064149386 10:12849955-12849977 CAGGAAGCATGGGGGGAAGGAGG - Intergenic
1065136086 10:22671601-22671623 CAGGATGCTGGGAGGCAAAGGGG + Intronic
1065292341 10:24243409-24243431 AAGGAGGGAGGGTGGGAAGGGGG - Intronic
1066044942 10:31586752-31586774 CAGGATGCAGAGTGAGAGGGTGG + Intergenic
1066477891 10:35765315-35765337 CAGGCTGCACGGTGGGAAGACGG - Intergenic
1067077470 10:43196412-43196434 GAGGACTCAGGGTGGGCACGAGG - Intronic
1067187900 10:44045520-44045542 CAGGATGCTGGGAGGGATGGAGG + Intergenic
1067738492 10:48877749-48877771 CAGGAGGCAGGCTGGGGACCAGG + Intronic
1067962387 10:50868985-50869007 GAGGATGCAGGGTGGGAGGAAGG + Intronic
1068525218 10:58120994-58121016 CAGGATGGAGGGTGGGAGGAGGG + Intergenic
1068898785 10:62240877-62240899 CCGGGTTCAGAGTGGGAACGGGG - Intronic
1069604578 10:69731486-69731508 CAGGATGGAGGGAGGGAGGGAGG - Intergenic
1069779108 10:70943746-70943768 GAAGATGCAGGGTAGGAAAGGGG - Intergenic
1069855977 10:71441243-71441265 CATGAGGCAGGGGGGGAGCGGGG - Intronic
1070540191 10:77410157-77410179 TAGGGTGCAGGGTGACAACGGGG - Intronic
1071444791 10:85735874-85735896 AAGGATGGAGGGAGGGAAGGAGG + Intronic
1073062558 10:100741271-100741293 CAGGAGGGAGGGAGGGAGCGAGG + Intronic
1074137915 10:110644120-110644142 CAGGAAGCGGGGAGGGAGCGCGG - Intergenic
1075000199 10:118791205-118791227 CAGGAAGAAGGGTGGGAGGGGGG + Intergenic
1075003578 10:118815119-118815141 AAGGAAGCAGGGTGGGGAAGAGG - Intergenic
1075226584 10:120634828-120634850 GAGGATGCAGGGAAGGACCGAGG - Intergenic
1075257796 10:120939263-120939285 CAGGACACAGGGCTGGAACGTGG + Intergenic
1075399833 10:122152790-122152812 CAGGACTCAGGGTGGGAACTGGG + Intronic
1075513758 10:123093442-123093464 GAGAATGCAGGGTGGGGAGGGGG + Intergenic
1075936039 10:126342127-126342149 CAGGATGCAGGTGGGGAATAGGG + Intronic
1076429716 10:130393273-130393295 CATGATGCAGGGAGGGAACATGG + Intergenic
1076452156 10:130563920-130563942 CAGGATCCTGGGTGGGATCCTGG - Intergenic
1076786950 10:132754643-132754665 CAGAAGACAGGGTGGGAAAGTGG + Intronic
1077770356 11:5211521-5211543 GAGTTTGGAGGGTGGGAACGGGG - Intergenic
1077825033 11:5797805-5797827 TAGGATGGAGGGTGGGAAGACGG + Intronic
1078470296 11:11580973-11580995 CAGGCTTCAGGGTGGCACCGTGG - Intronic
1078686837 11:13539898-13539920 CAGGAAGGAGGGTGGGAAGGGGG - Intergenic
1080458210 11:32433782-32433804 CAGGATACAAGGAGGGAACTCGG - Intronic
1082768156 11:57184780-57184802 CAGGATGCAGGGTGGGAACGTGG - Intronic
1082946587 11:58767821-58767843 GAGGATGGAGGGTGGGAAGAGGG + Intergenic
1083034958 11:59628514-59628536 CAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1083180437 11:60981721-60981743 CAAAATGGAGGGTGGGAACCTGG - Intronic
1083655353 11:64226640-64226662 CAGGATCCATGGTCTGAACGGGG - Exonic
1084092707 11:66889141-66889163 CAGGGTGAAGGGAGGGAAAGTGG + Intronic
1084379189 11:68800136-68800158 CAGGCAGCAGGATGGGAACGAGG + Intronic
1084859157 11:72006914-72006936 CAGGGTGAAGGGAGAGAACGTGG - Intronic
1084952403 11:72673971-72673993 CAGGCTGCAGTCTGGCAACGCGG + Intronic
1085423220 11:76381116-76381138 CAGGGTGCATTGTGGGAAGGAGG - Intergenic
1086245360 11:84745369-84745391 CAGGAAGAAGGATGGGAACAGGG - Intronic
1088343728 11:108798742-108798764 CAGGTTGCAGGGTGGGGTAGGGG + Intronic
1088651199 11:111959108-111959130 CTGGATGCAGGGCAGGAACTTGG + Intronic
1088674622 11:112180568-112180590 CTAGAAGCAGGGTGGGAAGGAGG + Intronic
1088895763 11:114077216-114077238 CAGGCTGCAGGCTGGGGAGGGGG - Intronic
1088994905 11:114987735-114987757 CAGGATGCTGGGTGGGCCGGAGG - Intergenic
1089294279 11:117458665-117458687 CAGGAGGCAGGGTGAGAGCAGGG - Intronic
1089696694 11:120220272-120220294 CAGGACGCAGGGTCTGAACCAGG - Intronic
1090074156 11:123568973-123568995 CAGGATGCTGGATGGGACTGGGG - Intronic
1090595614 11:128318191-128318213 CAGGGAGAAGGGTGGGAAGGGGG - Intergenic
1091648342 12:2290573-2290595 CACGAGGCTGGGTGGGAAGGTGG + Intronic
1092118360 12:6025771-6025793 GTGGCTGCAGGGTGGGAAGGAGG - Intronic
1094167692 12:27459469-27459491 CAGGGTGCAGGATGGGAAGAAGG + Intergenic
1096683132 12:53270099-53270121 CTGGAGGTAGGGTGGGGACGTGG + Intronic
1097118395 12:56716093-56716115 TAGGAGGCAGAGTGGGAACTGGG + Exonic
1097640109 12:62170771-62170793 AAGGATGGAGGGTGGGAAGGAGG - Intronic
1097801336 12:63917781-63917803 CAGAAAGCAGGGTGGGAAATTGG - Intronic
1101591760 12:106131137-106131159 CAGGGTGGAGAGTGGGAAAGGGG - Intronic
1101662048 12:106774620-106774642 CAGGACGGAGGGAGGGAAAGAGG + Exonic
1101876272 12:108598479-108598501 CAGGGTGCAGCGTGGGAGCTGGG + Intergenic
1102073538 12:110041832-110041854 CAGGATGCAGGTGAGGAACGAGG + Exonic
1102386722 12:112516310-112516332 CAGGGTTCAGGGTTGCAACGTGG + Intergenic
1102796669 12:115695004-115695026 CAGGAGGCAGAATGGGAAAGTGG - Intergenic
1103236325 12:119375790-119375812 CAGGATGCAATGTGGGGAAGTGG + Intronic
1104350837 12:128042615-128042637 CAGGATGCAGGGGGGGCTCGTGG - Intergenic
1104394805 12:128423434-128423456 CAGGATGAAGGGTGGACACAGGG + Intronic
1104414763 12:128589090-128589112 CAGGCTCCAGGGTGAGAACCAGG + Intronic
1104510034 12:129368932-129368954 CAGTATTCCAGGTGGGAACGAGG - Intronic
1104579705 12:130001978-130002000 CAGGATGGCGGGTGGGAAAATGG - Intergenic
1104893432 12:132150922-132150944 CAGGGGGTAGGGTGGGAGCGAGG + Intronic
1105202892 13:18194730-18194752 CAGGAGGCAGGGAGGGACCCTGG - Intergenic
1105307996 13:19182317-19182339 CCGGGTGCTGGGTGGGAAGGTGG - Intronic
1105707472 13:22977132-22977154 CAGGGTGCAGGGGAGGAACAAGG + Intergenic
1106264057 13:28093904-28093926 AAGGAGGAAGGGTGGGAAGGAGG + Intronic
1107671658 13:42752637-42752659 CAGGCTAAAGGGTGGGAATGTGG - Intergenic
1109284997 13:60398213-60398235 TGGGATGAAGGGTAGGAACGGGG + Intronic
1111160094 13:84383852-84383874 CAGGAGTCATGGTGGGAATGTGG - Intergenic
1112047914 13:95616244-95616266 CTGGGTGCAGGGTGGAAACGTGG + Intronic
1112535041 13:100245506-100245528 CAGGTTGTAGGGTGAGAAGGAGG + Intronic
1112690260 13:101885342-101885364 CAGGGTGGAGGGTGGGAGGGAGG + Intronic
1112847547 13:103662818-103662840 CAGGACCCAGGGTGGCAATGAGG - Intergenic
1113186122 13:107687301-107687323 CTGGATGGAGGGAGGGAAGGAGG + Intronic
1113802744 13:113094965-113094987 CAGGAGGCTGGGTGGGCACCTGG - Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115658077 14:35463125-35463147 TAAGGTGCAGGGTGGGAACCAGG - Intergenic
1117343670 14:54812624-54812646 CAGGATGAAGGAAGGGAAGGAGG - Intergenic
1118096652 14:62545254-62545276 CAGGTTTCAGGGTGGCAAAGTGG + Intergenic
1118806577 14:69242523-69242545 CAAGATGCAGGATGTGCACGTGG - Exonic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119425300 14:74531155-74531177 CAGGCGGCAGGGAGGGAAGGAGG + Intronic
1119432583 14:74578138-74578160 CAGGATGCAGGTTGGCCACTAGG - Intronic
1121448526 14:93993539-93993561 CAGGATGCAGAGTGGGGCTGCGG - Intergenic
1121527976 14:94632743-94632765 CTGGATGCAGGATGAGAACTTGG - Intergenic
1122031248 14:98914233-98914255 GAGGAAGCAGGGAGGGAAAGAGG + Intergenic
1122123214 14:99565599-99565621 CAGGAGGGAGGCTGGGAGCGGGG + Intronic
1122523545 14:102363414-102363436 CGGGATGCAGGGTGGGGCCGGGG - Intronic
1122909614 14:104820986-104821008 CAGGACGCAGAGTGCAAACGTGG - Intergenic
1122967182 14:105136823-105136845 CCGGCTGCAGGCTGGGAACCTGG - Intergenic
1124631188 15:31338605-31338627 CAGGATGGAGGGTGGGACCCTGG + Intronic
1125546949 15:40512820-40512842 GAGGATGCAGGCTGGGATTGGGG - Intergenic
1126213292 15:46125274-46125296 CAGGATGGAGGGTGGGAGGAGGG + Intergenic
1127825675 15:62700697-62700719 CAGGGTGCAGGGTGAGAAAGAGG - Intronic
1128730093 15:70015087-70015109 CAGGTTGCAGGCTGGGCCCGTGG + Intergenic
1129107088 15:73317962-73317984 CAGGACGCCGGCTGGGAAGGAGG + Intergenic
1129689380 15:77704850-77704872 CAGGGTTCAGGGTGGGACCAGGG - Intronic
1130122190 15:81060647-81060669 AAGGATACAGTGTGGGAAGGAGG + Intronic
1130235881 15:82132985-82133007 CAGGAGGAAGGGAGGGAAAGTGG + Intronic
1130963512 15:88680817-88680839 CCAGATGCAGAGTGGGAAGGAGG + Intergenic
1131143101 15:89993513-89993535 GAGGGTGTAGGGTGGGAATGAGG - Intergenic
1131686411 15:94772742-94772764 CAGGGTGCAAGGTGAGAACCAGG - Intergenic
1132931855 16:2462739-2462761 CAGGTGGCAGGGTGGGGGCGGGG - Intronic
1133601184 16:7341870-7341892 TTGGATGCAAGGTGGGAAGGGGG - Intronic
1135991342 16:27220615-27220637 CAGGATGCAGGACAGGAATGGGG - Exonic
1136344311 16:29665017-29665039 CAGGGTGCCGGGTGGAAACATGG - Exonic
1137676657 16:50306986-50307008 CTGGAGGCAGGGTGGGCAAGTGG + Intronic
1138332650 16:56227398-56227420 CTGGAGACAGGGTGGGAACCAGG - Intronic
1138476145 16:57271716-57271738 CAGAGGGCAGGATGGGAACGGGG - Intronic
1139375749 16:66495378-66495400 AAGGATCCAGGGTGGGAGGGAGG - Intronic
1139397790 16:66654353-66654375 CAGGAGGCAGGATGGCAAGGGGG - Intronic
1140730569 16:77852309-77852331 CAGGATCAAGGGTGGGAGGGAGG - Intronic
1141297326 16:82782220-82782242 CAGGATTCAGGGTGGGCCTGTGG + Intronic
1141550515 16:84803703-84803725 GAGGGTGGAGGGTGGGAGCGGGG + Intergenic
1141952011 16:87345329-87345351 CGGGAGGCAGGGTGGGAGGGAGG + Intronic
1142033139 16:87848374-87848396 CAGGGCGGAGGGTGGGAGCGAGG - Intronic
1142147892 16:88500099-88500121 CAGGAAGCCGGGTGGGAGGGCGG - Intronic
1142191823 16:88721619-88721641 CAGGATGCGGGGCGGGAAGTAGG + Exonic
1142198169 16:88748375-88748397 CAGGCTGCAGGCTTGGCACGTGG + Intronic
1142769309 17:2085258-2085280 CAGGAGGGAGGGAGGGAACAAGG + Intronic
1143234911 17:5391204-5391226 CAGGAGGCAGTGCGGGTACGTGG + Intronic
1143520493 17:7441595-7441617 CTGGCTGCAGGGTGGGAAGGGGG + Intronic
1143572758 17:7770684-7770706 CAGGCTGCAGAGTGGGACCAAGG + Intronic
1144146867 17:12407099-12407121 CAGAATTCAGGGTGGGAAATGGG + Intergenic
1145365779 17:22265951-22265973 CAGGATGAAGGGAGGCAATGAGG + Intergenic
1146822555 17:35996057-35996079 CAGGAGGGAGGGAGGGAAGGGGG + Intronic
1147176462 17:38659012-38659034 CTGGAGGCAGGGTGGGCGCGAGG + Intergenic
1147241088 17:39091018-39091040 CAGGATGACGGGTGGGAACAGGG - Intronic
1147605539 17:41771983-41772005 GAGGATGCAGGCTGGGGATGGGG + Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1148025487 17:44584760-44584782 GAAGGCGCAGGGTGGGAACGTGG - Intergenic
1148739939 17:49887173-49887195 GAGGAAGCAGGATGGGAACTGGG - Intergenic
1148780907 17:50121238-50121260 CAGGAGGCAGGGAGCGAAGGAGG - Intronic
1148908438 17:50926564-50926586 CAGGATGTGGGCTGGGAAGGAGG + Intergenic
1149557227 17:57582150-57582172 CTGGAGGTAGGGTGGGAACAGGG - Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1149746908 17:59107213-59107235 CACGATGCTGGGTGAAAACGCGG - Intergenic
1150295172 17:64003526-64003548 CAGGATGAAGGGTGGGCTCCTGG + Intronic
1150580405 17:66468711-66468733 GAGGGTGGAGGGTGGGAAAGTGG + Intronic
1150645742 17:66976503-66976525 GAGGATGGAGGGAGGGAAAGAGG - Intronic
1150711369 17:67533304-67533326 CAGAATGCAAGGTGGGGAGGGGG - Intronic
1151228458 17:72664365-72664387 CAGAAGGCAGGGAGGGAAAGTGG + Intronic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1151813641 17:76460063-76460085 CTGGATGCAGAGGGGGAAGGGGG - Intronic
1151816648 17:76474490-76474512 CCGGATGCAGGGTGAGAACTTGG + Exonic
1151985848 17:77542976-77542998 CCCCATGCAGGCTGGGAACGGGG + Intergenic
1152325835 17:79635421-79635443 GAGGAGGCAGGAAGGGAACGTGG - Intergenic
1153382919 18:4457990-4458012 CAGGATGGAGGGTGGGCACCTGG + Intergenic
1154259063 18:12813103-12813125 CAGGAAGCAGGCAGGGAAGGCGG + Intronic
1155328227 18:24687698-24687720 GAGGATGGAGGGTGGGAAGAGGG - Intergenic
1155554356 18:27001685-27001707 CAGAATGCATGGTGGGAGGGTGG + Intronic
1156637469 18:39048887-39048909 CAGGAGGCAGGAAGGGAATGAGG + Intergenic
1156798579 18:41079675-41079697 GAGGAGGAAGGGTGGGAAGGAGG - Intergenic
1157728805 18:49986272-49986294 TAGGATGCAAGGTGGGAAATGGG - Intronic
1158559193 18:58499422-58499444 CAGGATGCAGGCTGAGACTGGGG - Intronic
1160920675 19:1518815-1518837 CAGGGAGCAGGGTGGGAGCTGGG - Intergenic
1161313880 19:3608955-3608977 CAGGAAGCTGGGTGGGGGCGGGG + Intergenic
1161329311 19:3678732-3678754 CAGGATGGAGGGAGGGACAGAGG + Intronic
1161329357 19:3678870-3678892 CAGGATGGAGGGAGGGATGGCGG + Intronic
1161857477 19:6773845-6773867 AGGGCTGCTGGGTGGGAACGGGG + Intronic
1161995852 19:7710794-7710816 AAGGAGGCAGGGAGGGAAGGAGG - Intergenic
1163471504 19:17500072-17500094 CTGAATGCAGGCTGGGAAGGTGG + Intronic
1163508332 19:17720921-17720943 CCGGATGCCTGGTGGGAAGGAGG - Exonic
1164523308 19:28995317-28995339 AAGGATGGAGGGTGGGAAGAGGG - Intergenic
1164814382 19:31183580-31183602 CAGCAAGCAGGTTGGGAACCAGG + Intergenic
1164815244 19:31194257-31194279 CAGTATTCAGTGTGGGAACCTGG - Intergenic
1164971102 19:32533216-32533238 GAGGATGGAGGCTGGGAAGGGGG + Intergenic
1166118131 19:40667923-40667945 CAGGAGGCATGGTGGGCACTGGG + Exonic
1166555842 19:43699510-43699532 CAGGGTGCAAGGAGGGGACGTGG - Intergenic
1166626919 19:44366367-44366389 AAGGAGGGAGGGTGGGAAGGAGG - Intronic
1166688445 19:44809439-44809461 CAGGGTGCTGAGTGGGAAGGGGG - Intronic
1167064622 19:47175170-47175192 CAGGATGCAGGGTGGCTTTGGGG + Intronic
1167145560 19:47679557-47679579 CAGGCTGCAGGGTGGGCAGCTGG - Exonic
1167429859 19:49447988-49448010 GAGGATGCAGGTTGGGGGCGGGG - Exonic
1168277495 19:55285605-55285627 CAGGATGGAGGGTGGGAAGGTGG + Intronic
1168327340 19:55545031-55545053 CAGGATGGAGGGTGGGGCAGGGG + Intronic
1168406477 19:56112993-56113015 CAAGAGGCAGGGTGGGAGCCAGG - Intronic
1168645294 19:58055554-58055576 CAGGATGGAGGGTGGGGTCTTGG + Intergenic
924981714 2:228732-228754 CAGGAGGCAGGTTGGTAATGAGG + Intronic
926310096 2:11669096-11669118 CTGGAGGTAGGGTGGGGACGGGG - Intronic
927213200 2:20651124-20651146 CGGGAGGCAGGGCGGGGACGCGG - Intergenic
927683432 2:25154959-25154981 CAGGATGCAGGGCTGGCAGGAGG + Exonic
927717620 2:25362757-25362779 CAGGATCCAGGCTGTGCACGGGG + Intergenic
928126607 2:28620788-28620810 GAGCATGCAGGGTGGGGACATGG - Intronic
928359893 2:30654644-30654666 AAGGAGGCAGGGTGGGGAGGGGG - Intergenic
930601748 2:53451818-53451840 AAGGGGGCAGGGAGGGAACGGGG - Intergenic
934519379 2:95010363-95010385 CCGGAGGCTGGGTGGGAAGGCGG + Intergenic
934619150 2:95793556-95793578 CAGGGTGAGGGGTGGGAATGGGG + Intergenic
934641741 2:96031001-96031023 CAGGGTGAGGGGTGGGAATGGGG - Intronic
934675105 2:96244232-96244254 CAGGGTAAAGGGTGGGAAGGGGG + Intergenic
934905337 2:98196114-98196136 CAGGGTGCTGGGTGGGGATGGGG + Intronic
934992353 2:98930474-98930496 CAGGACAGAGGGTGGGGACGGGG - Intronic
936275049 2:111088631-111088653 TAGGGTGCAGGGTGGGAAGAGGG + Intronic
936275256 2:111090634-111090656 CAGGATGCATGGTGTGAGCCTGG + Intronic
936679814 2:114757212-114757234 CAGGAGGAAGGGTGGGGAAGAGG + Intronic
937268297 2:120631061-120631083 CAGGATGCAGGGAGTGAGCTTGG - Intergenic
937315980 2:120932371-120932393 CAGGATCCTGAGAGGGAACGGGG - Intronic
937424698 2:121789371-121789393 CAGCCTGCAGGGTGGGTAGGGGG + Intergenic
938123084 2:128647223-128647245 CAGGATGCAAGTTTGGAACATGG - Intergenic
938299310 2:130198860-130198882 CCGGGTGCTGGGTGGGAACAGGG - Intergenic
938546587 2:132338173-132338195 AAGGAGGGAGGGTGGGAAGGAGG + Intergenic
939036923 2:137143416-137143438 CAGGCAGCAGGGTGGAAAGGAGG + Intronic
939200876 2:139031954-139031976 CAGGTTGCATGGTGGGTAGGTGG + Intergenic
943543557 2:189246668-189246690 CAGACTGCAGTGTGAGAACGTGG + Intergenic
945192956 2:207208862-207208884 CACGATACAGGGTGGTCACGGGG + Intergenic
945604417 2:211910574-211910596 CAGGGTGGAGGGTGGGAAGATGG + Intronic
946328831 2:218998673-218998695 CAGGAACCAGGGTGAGAAGGAGG - Intergenic
946653249 2:221916934-221916956 GAGAATGAAGGGTGGGAAGGTGG - Intergenic
947679945 2:232021486-232021508 CGGGATCCAGGCTGTGAACGTGG + Intronic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948358224 2:237397509-237397531 GAGGAGGCAAGGTGGGAAGGTGG + Intronic
948882691 2:240868569-240868591 CAGGACTCAGAGTGGGAGCGAGG + Exonic
948915937 2:241035125-241035147 CAGGAGGCTGGGTGGGAATAAGG - Intronic
1168775726 20:445900-445922 CAGGATTCAGGGTGTGAACATGG + Intronic
1168859454 20:1035485-1035507 CAGGATGGGGGTTGGGGACGTGG + Intergenic
1169546098 20:6652572-6652594 CAGGAGTCAGGGTGGGATCTAGG - Intergenic
1170200904 20:13742873-13742895 CAGGAGGGAGGGCGGGAACAGGG - Intronic
1170559110 20:17540633-17540655 AAGGATGGAGGGTGGGCACCTGG - Intronic
1171163659 20:22951770-22951792 CAGAACGCAGGGTGGGCACAAGG + Intergenic
1171204288 20:23266972-23266994 CAGGAGGCAGGGTGGGTGGGAGG + Intergenic
1171875450 20:30570907-30570929 AAGGAGGGAGGGTGGGAAGGAGG + Intergenic
1172205867 20:33162494-33162516 CAGGATTAAGGGTGGGAAAGAGG - Intronic
1172645885 20:36469300-36469322 CAGGATGCAGGTTAGGAGCCTGG - Intronic
1173112542 20:40205750-40205772 CGGGATTCTGGGTGGGAACAGGG + Intergenic
1173465225 20:43275560-43275582 CAGGTTTCAGGGTTGGAACATGG + Intergenic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173650918 20:44663519-44663541 CAGGATGGAGGATGGGAAGCAGG + Intergenic
1174799717 20:53553226-53553248 CTGGGTGCAGGGTTGGAACTTGG + Intergenic
1175042896 20:56072483-56072505 CAGGAGCCAGTGTGGGAAAGTGG + Intergenic
1175825398 20:61933984-61934006 AAGGATGCAGGGTGGAAGGGGGG + Intronic
1176297969 21:5084542-5084564 CAGGAGGCAGGGTGGCAGCAAGG + Intergenic
1179859060 21:44177407-44177429 CAGGAGGCAGGGTGGCAGCAAGG - Intergenic
1180156366 21:45979316-45979338 CAGGATGAAGCCTGGGACCGGGG + Intergenic
1180569792 22:16704184-16704206 GTGGCTGCAGGGTGGGAAGGAGG - Intergenic
1180959970 22:19758128-19758150 GAGGATGCTGGCTGGGAACTGGG - Intronic
1181054327 22:20252935-20252957 CAGGATGCTGGGTGGGGGCCTGG - Intronic
1181415474 22:22755776-22755798 CAGGACCCAGGGTGGGGACAAGG + Intronic
1181436609 22:22914796-22914818 CTGGATCCAGGCTGGGAACAAGG + Intergenic
1181536423 22:23548651-23548673 CAGGATGCCAGGTGGGCAAGGGG + Intergenic
1181643365 22:24216587-24216609 CCAGCTGCAGGGTGGGTACGTGG - Intergenic
1182130382 22:27845927-27845949 AAGGATGAGGGGTGGGAAGGGGG + Intergenic
1182437550 22:30340539-30340561 CAGGTTTCATGGTGGGAACAGGG - Intronic
1182467857 22:30529045-30529067 CAGGATCCAGGCTGGAAAAGAGG + Intronic
1183539834 22:38423568-38423590 CCGGATGCAGGGTGGGGAAGGGG - Intergenic
1183546309 22:38456098-38456120 CAGGATCCAGGGCAGGAGCGGGG - Intergenic
1184413400 22:44338476-44338498 CAGGATCCTGGGAGGGAAAGAGG + Intergenic
1184668782 22:46002119-46002141 CAGGAGCCAGGGTGGGCAAGGGG - Intergenic
1185009175 22:48303572-48303594 CATGAGGCAGGGAGGGGACGGGG + Intergenic
1185098020 22:48822220-48822242 CAGGATGTAGGGTGGTGAGGAGG - Intronic
1185175537 22:49324425-49324447 CTGGAAGCAGAGTGGGGACGTGG - Intergenic
1185242103 22:49752147-49752169 CAGGGGGCAGGGTTGGAAAGAGG + Intergenic
949512478 3:4778936-4778958 CAGGATGTGGGGTGTGAACATGG + Intronic
949576729 3:5345623-5345645 CAGGAGGCAGAGGGGGAACTGGG + Intergenic
949669674 3:6384800-6384822 CAGGATGCAGTATGGGAAACGGG + Intergenic
950544061 3:13628649-13628671 CTGGAGGCAGGGCGGGATCGAGG - Intronic
951859657 3:27237645-27237667 CAGGAGGAAGGGTGGGAGTGGGG + Intronic
952377593 3:32780574-32780596 CAGGCTCCAGGGTGGGAGTGGGG + Intergenic
952389085 3:32864605-32864627 CAGGATGCAGGATGTCAACAGGG + Intronic
952708599 3:36406149-36406171 CAGGCTGCTGGGTGGGGAGGGGG - Intronic
953008727 3:39003171-39003193 GAGGATGGAGGGTGGGAAGTGGG - Intergenic
954712606 3:52512524-52512546 CAGGATCCATGGTGGGGAAGGGG + Intronic
956330449 3:68101152-68101174 GAGGATGGAGGGTGGGAAGAAGG - Intronic
958087697 3:88833058-88833080 GAGGAGAGAGGGTGGGAACGGGG + Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959673396 3:109005656-109005678 CAGGAAGCAGGATGTGAATGTGG - Intronic
961957504 3:130819165-130819187 CAGGATGCAGGGTGGGGGCTGGG - Intergenic
962951492 3:140223766-140223788 CATGTTGCAGGGTGGGGACCAGG - Intronic
967493990 3:190122394-190122416 CAGGAGGCAGGCTGGGATCCAGG - Intronic
968114909 3:196081990-196082012 CAGGATGAAGGGAGGACACGAGG + Intronic
968593983 4:1473077-1473099 CAGGTGGCAGGGTGGGCAGGTGG - Intergenic
968731755 4:2272399-2272421 TAGGATCCAGGGTGGGAAAGGGG - Intronic
969758063 4:9162809-9162831 CAGGAGGCTGGCTGGGCACGGGG + Intergenic
969855564 4:9996473-9996495 CAGGATGGAGGGTGGGAGGAGGG + Intronic
970001119 4:11367075-11367097 AAGGAGGCAGGGAGGGAAGGAGG + Intergenic
971380321 4:26091290-26091312 CCGGGTGAAGGGTGGGAGCGGGG - Intergenic
972390390 4:38607810-38607832 GAGGATGCTGGGAGGGAACAGGG - Intergenic
975217216 4:71769758-71769780 GAGGAAGCAGGGTGGGAAGGAGG - Intronic
978897609 4:113907937-113907959 CAGGATGGAGGGTGGGAGAAGGG + Intronic
981674237 4:147322821-147322843 CAGGAGGGAGGGAGGGAAAGAGG + Intergenic
984244439 4:177258031-177258053 GAGGATGCAGGGTGGGAAGAGGG - Intergenic
985408631 4:189661095-189661117 GAGGATGCACGCTGTGAACGTGG + Intergenic
985930742 5:3055744-3055766 CCGGATGCTGGGTGGGAAAAGGG - Intergenic
986579677 5:9252310-9252332 CAGATTACAGGGTGGGAATGGGG - Intronic
989161052 5:38392098-38392120 GAGGATGGAGGGTGGGAATAGGG - Intronic
990816752 5:59794477-59794499 CAGGAGGGAGGGAGGGAAGGAGG - Intronic
991166264 5:63567617-63567639 CAGGTTGCTGGGTGGGACCCCGG - Intergenic
992487446 5:77210433-77210455 GAGGAAGGAGGGTGGGAGCGAGG + Intronic
992591863 5:78303947-78303969 GAGGATGGAGGGTGGGAAGAGGG - Intergenic
992683943 5:79180725-79180747 AAGGATGGAGGGTGGGAGCCAGG + Intronic
993446699 5:88021327-88021349 CAGCCTGCAGGGAGGAAACGGGG + Intergenic
993975654 5:94476468-94476490 AAGGCTGCATGGTGGGAACAGGG + Intronic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994373485 5:98992926-98992948 AAGGGTGGAGGGTGGGAAGGAGG + Intergenic
995716812 5:115088453-115088475 CAGGATGCGGTGGGTGAACGTGG - Intergenic
995853167 5:116568152-116568174 CAGGGTCCAGAGTGGGAAAGAGG + Intronic
997953709 5:138262170-138262192 CAGGAAGCAGGCTGAGAATGCGG + Intronic
998225749 5:140324998-140325020 CAAGATGCTGGGTGGGAAGAAGG + Intergenic
998354665 5:141525036-141525058 TAGGATGCAGTGGGGGAAGGTGG - Intronic
999278668 5:150349947-150349969 CAGGGTGCTGGGTGAGAATGAGG + Intergenic
999367603 5:151033340-151033362 AAGAGTGCAGGGTGGGAAGGAGG - Intronic
999876955 5:155818293-155818315 CAGCATTCAGGGTTGGAAGGAGG + Intergenic
1000327603 5:160184209-160184231 AAGGATGGAGGGAGGGAAGGAGG - Intergenic
1001100065 5:168806915-168806937 CAGGATGCATCCTGGGAAAGTGG - Intronic
1001721455 5:173860341-173860363 AAGGTTGCAGGGTGGGGACCTGG + Intergenic
1002566017 5:180113287-180113309 CAGGATGGACGGAGGGACCGGGG + Intronic
1002880827 6:1250996-1251018 CAGGCTGCAGGGTGGGTGCTTGG - Intergenic
1003472785 6:6452372-6452394 TAGGATGTAGGGAGGGAATGGGG + Intergenic
1004696982 6:18042981-18043003 CTAGATGCAGGGTGAGAACTCGG + Intergenic
1005294168 6:24407967-24407989 CAGGATTCTGGCTGGGAACATGG + Intronic
1005942822 6:30573560-30573582 CAGGAAGCAGGTGGGGAAGGAGG + Intronic
1006579080 6:35066214-35066236 AAGGACGCAAGGTGGGAAGGTGG + Intronic
1006618227 6:35343865-35343887 CAGGGTGGAGGGTGGGAGTGAGG - Intronic
1006864028 6:37193983-37194005 CAAGATGCAGGGTTGGGATGGGG - Intergenic
1007150956 6:39690498-39690520 CAGGAGGCTGGGTGGGCAAGTGG + Intronic
1007445491 6:41902331-41902353 CAGGAGGCAGTGTGGGAGCAGGG + Intergenic
1007559098 6:42791085-42791107 CAGAATGCTGTGTGGGAAGGTGG + Intronic
1007850033 6:44793928-44793950 CAGGAGCCAGAGTGGGAAAGTGG - Intergenic
1011993819 6:93559481-93559503 GAGGATGGAGGGTGGGAAGAGGG - Intergenic
1012314333 6:97767201-97767223 CAGGGGGCAGGGTGGGGAGGGGG - Intergenic
1013421740 6:109973154-109973176 GAGGATGCAGGGTGGGAGGAAGG + Intergenic
1017881855 6:158567560-158567582 CTGGATGCTGGGTGGGATTGAGG + Intronic
1017923420 6:158890486-158890508 GAGGATGCACTGTGGGACCGTGG + Intronic
1018664678 6:166124685-166124707 AAGGGTGCAGTGTGGGAAAGAGG + Intergenic
1019065349 6:169291659-169291681 CAGCATGCGGGGTTGGAAAGAGG - Intergenic
1019290309 7:247021-247043 AAGGAGGCAGGGAGGGAAGGGGG + Intronic
1019524996 7:1476874-1476896 CAGGAGGTAGGGACGGAACGAGG + Exonic
1019543304 7:1560971-1560993 CAGGAGGCAGGGGTGGCACGTGG - Intergenic
1019643712 7:2118093-2118115 CAGGGTGGAGGGTGGGTAAGGGG - Intronic
1019737144 7:2656216-2656238 CAGCTTGTAGGGTGGGAACAGGG + Intronic
1019742354 7:2681108-2681130 GAGGATGCAGGGCTGGAGCGGGG + Intronic
1020578391 7:9963484-9963506 CAGGAAGCAGGCTGGGCATGGGG + Intergenic
1020787644 7:12590853-12590875 CAGATAGCAGCGTGGGAACGAGG + Intronic
1021176713 7:17458476-17458498 CAGGATGCTGGTTAGGAATGAGG - Intergenic
1022472163 7:30688653-30688675 CAGGATACAGGGTGGGACACTGG + Intronic
1022593763 7:31691624-31691646 AAAGATGGAGGGTGGGGACGGGG + Intronic
1023491831 7:40751248-40751270 CAGGATGAAAGGTGGGGAAGTGG + Intronic
1023932388 7:44713712-44713734 CTGGATGAAGGGTGGGGAGGGGG - Intergenic
1024476863 7:49821132-49821154 AAGGAAGCAGGGAGGGAAAGAGG + Intronic
1024986930 7:55202336-55202358 CAGGCTGCAGGGTGGGCAGCAGG - Intronic
1025212865 7:57030924-57030946 GAGTCTGCCGGGTGGGAACGTGG - Intergenic
1025659088 7:63545900-63545922 GAGTCTGCCGGGTGGGAACGTGG + Intergenic
1025847941 7:65217290-65217312 CAGGATGGGGGGTGGGGAGGAGG - Intergenic
1026420406 7:70230959-70230981 CAGGAAGCAGGGGTGGAACTAGG + Intronic
1026898056 7:74021950-74021972 CAGGATGCTGGGTGGGAGGCAGG - Intergenic
1027260633 7:76462089-76462111 CAGGGTGCCGGGTGCGAAAGGGG + Intronic
1027312012 7:76960202-76960224 CAGGGTGCCGGGTGCGAAAGGGG + Intergenic
1028021806 7:85785876-85785898 GATGAGGCAGGGTGGGAAAGGGG + Intergenic
1029582036 7:101443169-101443191 CAGGATGGGGGGTTGGAAAGAGG - Intronic
1029644311 7:101843711-101843733 CAGGCTGAAGGGAGGAAACGAGG - Intronic
1033283872 7:140024596-140024618 CAGGATGGAGGGTGTGACCGAGG + Exonic
1034457939 7:151181542-151181564 CAGGATGGAGGGTGGGTGGGGGG - Intronic
1034939300 7:155220160-155220182 CATGATGCAGTGTGGGACGGTGG + Intergenic
1035100862 7:156395352-156395374 CAGCATGCAGGGTGGCCCCGAGG - Intergenic
1035902032 8:3467210-3467232 AAGGATGCAGTTTGGGCACGAGG + Intronic
1035909013 8:3544731-3544753 CAGGATGCTGGGTGGAGACAGGG + Intronic
1036691594 8:10948005-10948027 CAGGGTGCAGGGTGGGTTAGGGG + Intronic
1037709401 8:21343680-21343702 CCGGATGTAGGATGGGAAGGAGG - Intergenic
1038482389 8:27910582-27910604 CAGGCTGCAGTGTGGAAACTGGG + Intronic
1038606850 8:29015322-29015344 CAGGATGGAGGGTGGGCAATAGG - Intronic
1039955303 8:42202735-42202757 CACGCAGCAGGGTGGGGACGGGG + Intronic
1041172389 8:55157665-55157687 GAGGGTGCAGGGTGGGAAGAGGG - Intronic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042621560 8:70711625-70711647 GAGGATGCAGGGTGGGAAGAGGG + Intronic
1042621591 8:70711829-70711851 GAGGATGCAGGGTGGGAAGAGGG + Intronic
1043979473 8:86621632-86621654 CAGGGAGAAGGGTGGGAAGGGGG - Intronic
1043993860 8:86788666-86788688 CTGGCTGCAGGGTGGGGACCAGG + Intergenic
1044666907 8:94641100-94641122 CAGGAAGGGGGGTGGGAAGGAGG - Intronic
1044763020 8:95542296-95542318 CAGGGTGGAGGGTGGGGAGGAGG + Intergenic
1045529880 8:102974384-102974406 CGGGAGGAAGGGTGGGAAGGAGG - Intronic
1047008235 8:120643417-120643439 CAGGAGGAAGGGTGGGAGGGTGG - Intronic
1047294570 8:123559518-123559540 CAGGAGACAGGGTGGGGATGGGG + Intergenic
1047412917 8:124638757-124638779 CAGGATGCAGGAGGGTAACAAGG + Intronic
1047660384 8:127027373-127027395 GAGGATGGAGGGTGGGAGCAGGG + Intergenic
1048369541 8:133765734-133765756 CAGGATCTGGGGTGGGAATGGGG - Intergenic
1048545450 8:135382462-135382484 GAGGGTGGAGGGTGGGAAGGAGG - Intergenic
1048779636 8:137987184-137987206 CAGGAAGCAGGCTGGGAAGCTGG - Intergenic
1049846889 8:144807195-144807217 CAGGATGGAGGCTGGGATCATGG + Exonic
1050008869 9:1164303-1164325 AAGGATGGAGGGAGGGAAGGAGG - Intergenic
1051234995 9:14990431-14990453 CAGGTTTCAGGTTGGGAATGAGG - Intergenic
1051960240 9:22751648-22751670 CAGAATGCAGGGTGGGAGAGAGG + Intergenic
1052885066 9:33638427-33638449 CAGGCTGCAGGGTGGGTTCTTGG - Intergenic
1055383052 9:75730107-75730129 CAGGAAGCATGGTGAGAAAGTGG + Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056485307 9:87051024-87051046 GAGGATGGAGGGTGGGAAGAGGG - Intergenic
1057030859 9:91774256-91774278 CAGCATGCAGGGTGGCAGTGAGG - Intronic
1058935764 9:109767907-109767929 CAGGATGGAAGGAGGGAAGGTGG + Intronic
1059206214 9:112468648-112468670 CAGGATGCAGGTGGAGAAAGAGG - Intronic
1060201274 9:121652787-121652809 CAGCCTGCAGGGTGGGAATGTGG - Intronic
1060556753 9:124511903-124511925 CAGGCTGCAGAGTGGAAAGGTGG + Intergenic
1060775000 9:126366736-126366758 CAGGAGGCTGGGTGGGAACTGGG - Intronic
1061245425 9:129399077-129399099 CAGGATGCCAGGTGGGCAAGGGG - Intergenic
1061591480 9:131600499-131600521 CAGGAGGCAGGCTGGGCAGGTGG + Intronic
1062006487 9:134240818-134240840 GAGGAGACAGGGTGGGAAGGAGG + Intergenic
1062328235 9:136023031-136023053 CAGGAAGGAGGGAGGGAAGGAGG + Intronic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062645212 9:137544301-137544323 CAGCATGCAGGGTGTGACCCAGG - Intronic
1185602316 X:1348841-1348863 GAGGAAGTAGGGTGGGAAGGAGG - Intronic
1186079293 X:5912897-5912919 CAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186300289 X:8193372-8193394 CAGGGTGCAGGGTGGGAGTAGGG - Intergenic
1187945616 X:24423796-24423818 CAGCAGGCAGGTTGGGAAAGAGG + Intergenic
1188738262 X:33744561-33744583 CAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1189104353 X:38220920-38220942 CAGGAAGGAGGGAGGGAAAGAGG - Intronic
1189318703 X:40074295-40074317 CAGCAGGCTGGGTGGGAAGGTGG + Exonic
1189908792 X:45789015-45789037 CAGGATGCTGGCTGGGACTGTGG - Intergenic
1192435489 X:71141126-71141148 GAGGAAGCAGGGTGGGAGCTCGG - Intronic
1192560593 X:72125565-72125587 CAGGAAGCACTGTGGGAATGGGG - Intergenic
1193289688 X:79757167-79757189 CAGGATGGAGGGTGGGAGGAGGG - Intergenic
1194347369 X:92782817-92782839 CAGGGGGAAGGGTGGGAAAGAGG + Intergenic
1196697939 X:118634293-118634315 CATGATGCAGGCAGGGAACGAGG - Intronic
1197708361 X:129649685-129649707 CAGGATGCAGGGTGTGATCTGGG - Intronic
1198556705 X:137801364-137801386 CAGGAAGCAGGGTGAGATGGGGG - Intergenic
1199536873 X:148912460-148912482 CAGGGTGGAGGGTGGGAAGAGGG + Intronic
1200831424 Y:7690911-7690933 CAGGCTTCAGGGGGGGAATGGGG + Intergenic
1200911341 Y:8534092-8534114 CAGGATGAAGGGAGGCAATGAGG + Intergenic
1200916199 Y:8573351-8573373 CAGGATGAAGGGAGGCAATGAGG + Intergenic
1200919137 Y:8597568-8597590 CAGGATGAAGGGAGGCAATGAGG + Intergenic
1200919585 Y:8601392-8601414 CAGGATGAAGGGAGGCAGCGAGG + Intergenic
1200930420 Y:8691950-8691972 CAGGATGAAGGGTGGCAGTGAGG - Intergenic
1201490214 Y:14532853-14532875 AAGGATGGAGGGAGGGAAGGAGG - Intronic
1202149847 Y:21834820-21834842 CAGGATGAAGGGTGGCAGTGAGG + Intergenic