ID: 1082771427

View in Genome Browser
Species Human (GRCh38)
Location 11:57210796-57210818
Sequence CTGTCTGCACCGTTGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082771427_1082771434 29 Left 1082771427 11:57210796-57210818 CCATCCTCCAACGGTGCAGACAG No data
Right 1082771434 11:57210848-57210870 TGGACATTAAACAGCCTCCGAGG No data
1082771427_1082771433 9 Left 1082771427 11:57210796-57210818 CCATCCTCCAACGGTGCAGACAG No data
Right 1082771433 11:57210828-57210850 TGTGACTGACATTGTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082771427 Original CRISPR CTGTCTGCACCGTTGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr