ID: 1082773101

View in Genome Browser
Species Human (GRCh38)
Location 11:57224044-57224066
Sequence GATGTTGGTGGGTCACATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082773101_1082773110 12 Left 1082773101 11:57224044-57224066 CCCTAATGTGACCCACCAACATC No data
Right 1082773110 11:57224079-57224101 CTCTGAAGTAGCTTCCTAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082773101 Original CRISPR GATGTTGGTGGGTCACATTA GGG (reversed) Intergenic
No off target data available for this crispr