ID: 1082773124

View in Genome Browser
Species Human (GRCh38)
Location 11:57224242-57224264
Sequence CAGGTCATGTAGGACCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082773124_1082773133 20 Left 1082773124 11:57224242-57224264 CCTTCAAGGTCCTACATGACCTG No data
Right 1082773133 11:57224285-57224307 GTCTCAGGCCACCCCCTGCCTGG No data
1082773124_1082773135 28 Left 1082773124 11:57224242-57224264 CCTTCAAGGTCCTACATGACCTG No data
Right 1082773135 11:57224293-57224315 CCACCCCCTGCCTGGCTTCCTGG No data
1082773124_1082773132 5 Left 1082773124 11:57224242-57224264 CCTTCAAGGTCCTACATGACCTG No data
Right 1082773132 11:57224270-57224292 TTTTTGGCTCTCTTTGTCTCAGG No data
1082773124_1082773136 29 Left 1082773124 11:57224242-57224264 CCTTCAAGGTCCTACATGACCTG No data
Right 1082773136 11:57224294-57224316 CACCCCCTGCCTGGCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082773124 Original CRISPR CAGGTCATGTAGGACCTTGA AGG (reversed) Intergenic
No off target data available for this crispr