ID: 1082773902

View in Genome Browser
Species Human (GRCh38)
Location 11:57231078-57231100
Sequence CCTGTCGTGGAGACAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082773902_1082773910 21 Left 1082773902 11:57231078-57231100 CCTTCCATTGTCTCCACGACAGG No data
Right 1082773910 11:57231122-57231144 CCCTTAGAACTCACCACCCTGGG No data
1082773902_1082773908 20 Left 1082773902 11:57231078-57231100 CCTTCCATTGTCTCCACGACAGG No data
Right 1082773908 11:57231121-57231143 TCCCTTAGAACTCACCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082773902 Original CRISPR CCTGTCGTGGAGACAATGGA AGG (reversed) Intergenic
No off target data available for this crispr