ID: 1082774253

View in Genome Browser
Species Human (GRCh38)
Location 11:57233811-57233833
Sequence AGTGTTCACTGGATGCTTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082774248_1082774253 -3 Left 1082774248 11:57233791-57233813 CCCTTCTAGAAGCCTCTTCCAGT 0: 1
1: 0
2: 1
3: 24
4: 183
Right 1082774253 11:57233811-57233833 AGTGTTCACTGGATGCTTTGAGG 0: 1
1: 0
2: 1
3: 14
4: 203
1082774249_1082774253 -4 Left 1082774249 11:57233792-57233814 CCTTCTAGAAGCCTCTTCCAGTG 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1082774253 11:57233811-57233833 AGTGTTCACTGGATGCTTTGAGG 0: 1
1: 0
2: 1
3: 14
4: 203
1082774247_1082774253 17 Left 1082774247 11:57233771-57233793 CCTCAGAGGGACAATTTCTTCCC 0: 1
1: 0
2: 3
3: 9
4: 192
Right 1082774253 11:57233811-57233833 AGTGTTCACTGGATGCTTTGAGG 0: 1
1: 0
2: 1
3: 14
4: 203
1082774246_1082774253 26 Left 1082774246 11:57233762-57233784 CCACGGCGGCCTCAGAGGGACAA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1082774253 11:57233811-57233833 AGTGTTCACTGGATGCTTTGAGG 0: 1
1: 0
2: 1
3: 14
4: 203
1082774245_1082774253 27 Left 1082774245 11:57233761-57233783 CCCACGGCGGCCTCAGAGGGACA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1082774253 11:57233811-57233833 AGTGTTCACTGGATGCTTTGAGG 0: 1
1: 0
2: 1
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082774253 Original CRISPR AGTGTTCACTGGATGCTTTG AGG Exonic
902745550 1:18471402-18471424 AGTGTTTACAGGATGGATTGAGG - Intergenic
903011697 1:20335569-20335591 ACTGTTGACTGGAGGCTTTACGG + Intronic
904289219 1:29473354-29473376 AGTGTTCCCTGGCAGCTGTGGGG - Intergenic
905113649 1:35617850-35617872 AATGTTCACTGGTTGCTGTATGG - Intronic
905254683 1:36672671-36672693 ACTTTCCACTGGGTGCTTTGTGG + Intergenic
906227849 1:44136702-44136724 ACTGTGCACTGGCTGCTTTCTGG - Intergenic
906737076 1:48140689-48140711 AGTATTCACTACATGTTTTGTGG + Intergenic
907284483 1:53371062-53371084 AGTGTGCACTGCCTACTTTGGGG + Intergenic
909340295 1:74524138-74524160 AGAATTCACTGGAGCCTTTGTGG - Intronic
909797240 1:79756707-79756729 AGTGTGAAATGGAGGCTTTGTGG - Intergenic
910505264 1:87943301-87943323 GGTCTTCACTGAATTCTTTGTGG - Intergenic
912975210 1:114323457-114323479 GGTGTACAATGGGTGCTTTGGGG + Intergenic
913672587 1:121111601-121111623 AGTGTACTCTAGCTGCTTTGTGG + Intergenic
914024356 1:143898966-143898988 AGTGTACTCTAGCTGCTTTGTGG + Intergenic
914662838 1:149806987-149807009 AGTGTACTCTAGCTGCTTTGTGG + Intronic
915545857 1:156597336-156597358 AGAGAACACTGGATGCTTTGTGG + Intronic
916214835 1:162385650-162385672 AGTGTTCCCAGAATGGTTTGGGG + Intronic
916851487 1:168708893-168708915 AGCTTTGACTGGGTGCTTTGGGG + Intronic
917155875 1:171998388-171998410 AATGCTCACTGAGTGCTTTGTGG - Intronic
918127641 1:181598288-181598310 TGTGTTCAGTGGATGCCTTGAGG + Intronic
920062111 1:203234049-203234071 AGTGTACTCTGGCTGCTGTGTGG - Intronic
920127627 1:203706098-203706120 GGTGCTGCCTGGATGCTTTGAGG - Intronic
921932134 1:220763268-220763290 AGTTTTGACTGTTTGCTTTGGGG - Intronic
922175727 1:223195601-223195623 AGTGGTGATTGGCTGCTTTGAGG + Intergenic
922618904 1:226978884-226978906 AGTGTTCAGTGGGTGATTGGTGG - Intronic
922824502 1:228508367-228508389 AGTCTTCACTGGCTGATTTCAGG - Intergenic
1064943343 10:20759461-20759483 TGTGTTCACAGGATGCTAAGTGG + Intergenic
1069113773 10:64478569-64478591 AGTGGTCACTTAATGCTATGGGG - Intergenic
1070624466 10:78040789-78040811 AGTTTTCACTGAATGCTTCATGG - Intronic
1071677939 10:87674019-87674041 AGTGCTCATTGAGTGCTTTGTGG + Intronic
1072986768 10:100147602-100147624 GGTGTTCACTGGGTGCTGTGGGG - Intergenic
1073178136 10:101569046-101569068 AGTGTTTACTGTAGTCTTTGGGG - Intergenic
1074191267 10:111139641-111139663 AGTGTCCCCTGGATGCATTAGGG - Intergenic
1075087264 10:119421968-119421990 AGAGTCCACTGGATGGTTTCTGG - Intronic
1076765202 10:132629606-132629628 AGTGTTCACTTGCTGCTGCGTGG + Intronic
1076803443 10:132843627-132843649 AGTGTTCCCAGGGTGCTGTGGGG + Intronic
1080323669 11:31044692-31044714 ACTGTTATCTGGATGCTCTGGGG - Intronic
1080323875 11:31048108-31048130 AGTACTCACTGTATGATTTGGGG - Intronic
1082774253 11:57233811-57233833 AGTGTTCACTGGATGCTTTGAGG + Exonic
1083264349 11:61539438-61539460 AGCGTTTTCTGGGTGCTTTGTGG + Intronic
1083329294 11:61890215-61890237 AATCTTCACTGGACTCTTTGAGG - Intronic
1084137589 11:67197901-67197923 ACTGTTTACTGGATGCCTTATGG + Intronic
1087252393 11:95917591-95917613 ACTGTTGACTGGAAGCTTTACGG + Intronic
1087887991 11:103502546-103502568 ATTGTTCCATGGATGCTATGAGG + Intergenic
1090857578 11:130623714-130623736 AGTTCTCACTGGATGCTCAGTGG + Intergenic
1094373372 12:29763296-29763318 GGTGTTCAGTGCATGCTTAGTGG - Intronic
1100842600 12:98628934-98628956 AGGGGGCAATGGATGCTTTGAGG + Intronic
1102879068 12:116470339-116470361 ACTGTGCACTGGGTGCTATGTGG - Intergenic
1104281623 12:127383177-127383199 CGTATTCACTGGCTGGTTTGGGG + Intergenic
1105637497 13:22229541-22229563 GGTGTGCACTGTATGCTTTGCGG + Intergenic
1106324206 13:28672370-28672392 ATCTTTCACTGGATGTTTTGAGG + Exonic
1107083871 13:36405124-36405146 TATGTTCACTGGAGGCTCTGGGG + Intergenic
1108676644 13:52742843-52742865 AGTGGTGAGTGGATACTTTGGGG + Intergenic
1110274227 13:73625660-73625682 GGTGTTCGCTGGAACCTTTGTGG - Intergenic
1113319028 13:109214000-109214022 AGTGCTCCCTGGGGGCTTTGGGG + Intergenic
1113830262 13:113290256-113290278 AGTCTTCACAGGATGCTTTTGGG - Intergenic
1115487480 14:33925996-33926018 AGTGTTTACTGGAGGCTTTTTGG - Intronic
1119421602 14:74510713-74510735 AGTGTTGAATAGACGCTTTGAGG - Intronic
1119698202 14:76731019-76731041 TGTGATCACTGGAAGCTTGGGGG - Intergenic
1119812787 14:77537241-77537263 AGTGTTCTTTGGTTTCTTTGGGG - Intronic
1120585737 14:86309774-86309796 AGTGTTCACTGTGTGTTTTAGGG - Intergenic
1122980537 14:105190514-105190536 ACTGTTCACTGCATACTTTTAGG + Intergenic
1123771087 15:23530100-23530122 ACTGTTTGCTAGATGCTTTGAGG - Intergenic
1126762576 15:51982854-51982876 AATCTTCACTGGATTCTTTAGGG - Intronic
1127841791 15:62838229-62838251 GGTGCTCACTGAAGGCTTTGAGG - Intronic
1130337232 15:82966938-82966960 AGAGTTGACTTGTTGCTTTGTGG - Intronic
1130645906 15:85726789-85726811 ATTGCTGACTGGATTCTTTGGGG + Intronic
1131910993 15:97201076-97201098 ATTGCTCACTGTATTCTTTGGGG - Intergenic
1133581714 16:7150762-7150784 AGTGTTCACTGCAGCATTTGTGG + Intronic
1135178603 16:20253402-20253424 AATGTTCATTGGTTGCTTAGAGG - Intergenic
1137348520 16:47688175-47688197 AGTGTTCACTGAAGGATTTAAGG + Intronic
1139470149 16:67174068-67174090 GGTGTTCACTGGGGGCATTGAGG + Intronic
1139559220 16:67731025-67731047 AGTGCTCAATGGCTGCTGTGGGG - Intronic
1140169477 16:72588455-72588477 AGTGTTCTCTGAAGGTTTTGGGG + Intergenic
1141253338 16:82378851-82378873 AGTGGTCAGTGGATGGCTTGTGG - Intergenic
1142051841 16:87964250-87964272 CGTATTCACTGGATGCGGTGCGG + Intronic
1142234249 16:88914342-88914364 CGTGTGCACGTGATGCTTTGTGG + Intronic
1144289101 17:13808338-13808360 ATTGTTCCCTTGTTGCTTTGGGG - Intergenic
1146824937 17:36013795-36013817 AGTGAACACGGGATGCTTCGTGG + Exonic
1146832492 17:36081911-36081933 ACTGTTCAGGGGATGATTTGGGG + Intergenic
1146846972 17:36188228-36188250 ACTGTTCAGGGGATGATTTGGGG + Intronic
1151228462 17:72664383-72664405 AGTGGTCAGTGGCAGCTTTGGGG + Intronic
1151774478 17:76190032-76190054 AGTGTTCACAGGGTGGTGTGGGG + Intronic
1155548116 18:26935801-26935823 AGTTTTCACTGGATCCTTACTGG + Intronic
1157017972 18:43742302-43742324 AGTGACCACTGGTTGCATTGTGG - Intergenic
1157222165 18:45836273-45836295 TGTCTCCACTGGGTGCTTTGAGG + Intronic
1158571771 18:58602434-58602456 AGTCTTCCCTGGAACCTTTGAGG - Intronic
1160501485 18:79403224-79403246 CGTCTTCACGGGGTGCTTTGAGG + Intronic
1164629143 19:29750065-29750087 ACTGTTCACTGTTTGGTTTGAGG - Intergenic
1165045865 19:33104448-33104470 AGTGTTTTCTGGCTGATTTGGGG + Intronic
1165191882 19:34071087-34071109 AGTGTTCACTGGTTCCGTGGGGG - Intergenic
926093902 2:10068336-10068358 AGTCTTCACTTGGTTCTTTGGGG + Intronic
926636588 2:15186565-15186587 AGTGCTGAAAGGATGCTTTGAGG - Intronic
929948433 2:46388167-46388189 AGTCTTCACTGGATTGCTTGAGG - Intergenic
931097527 2:58958003-58958025 AGTGTCCATTAGTTGCTTTGTGG + Intergenic
931295814 2:60924026-60924048 AGTGCATACTTGATGCTTTGAGG - Exonic
932599523 2:73113641-73113663 AGTGTTCACTCGGAGCCTTGGGG + Intronic
932706053 2:74025995-74026017 AGTGTTCCCTGGGAGCTATGAGG - Intronic
932922313 2:75930591-75930613 AGTGTTCACAGCAAACTTTGGGG - Intergenic
933665005 2:84957778-84957800 AGGGCTCTCTGGATGCTTAGAGG - Intergenic
937540151 2:122939949-122939971 AATGTTCCATGGATGCTCTGAGG + Intergenic
938382118 2:130842591-130842613 AGTGACTACTGGGTGCTTTGTGG - Intronic
939454555 2:142417460-142417482 TGTATTCACTGGACACTTTGGGG + Intergenic
941556064 2:166983613-166983635 AGTCTTGACTTCATGCTTTGTGG + Intronic
946654211 2:221928126-221928148 AATATTTACTGAATGCTTTGTGG - Intergenic
947534825 2:230933956-230933978 GGTGGTCACCGGAAGCTTTGGGG - Intronic
947704132 2:232260809-232260831 TGTATTCCCTGGAGGCTTTGTGG + Intronic
947877887 2:233480015-233480037 CATGATCACTGGCTGCTTTGTGG - Intronic
1169750488 20:8987752-8987774 AGTGTCCACAGGCTGCTTTCAGG + Intergenic
1174915320 20:54647577-54647599 ACTATTCACTGGATTCTTTTAGG + Intronic
1177293618 21:19147482-19147504 AATGTTCACAGGTTTCTTTGGGG + Intergenic
1180016383 21:45087847-45087869 AATGTTGACTGGATTCTGTGAGG + Intronic
1183354875 22:37352816-37352838 AGTAGCCACTGGAGGCTTTGTGG + Intergenic
949350421 3:3119851-3119873 AGTGTTCAATGGTGGTTTTGAGG + Intronic
950221750 3:11201514-11201536 ACTGTGTCCTGGATGCTTTGGGG + Intronic
952873773 3:37924944-37924966 GGTGGTCAGTGAATGCTTTGAGG - Intronic
953127606 3:40106863-40106885 TGTGTCCACTTGATGCTTTCTGG + Intronic
953462280 3:43091005-43091027 AGTTATCACTAGATACTTTGTGG - Intronic
955470355 3:59280401-59280423 AGTGTTCTTTAAATGCTTTGTGG - Intergenic
955497349 3:59547766-59547788 AGTGTTGACTGAGTGCATTGGGG - Intergenic
955960202 3:64332838-64332860 TGTGTTCTCTGAATGTTTTGGGG + Intronic
956321862 3:68006870-68006892 ATTGTTGGCTGGATGCTTTGGGG + Intronic
959090945 3:101902022-101902044 TGTTTTCTCTGTATGCTTTGTGG + Intergenic
961095345 3:124150234-124150256 AGTTTTCATTGGAAGCTTTTAGG - Intronic
962342528 3:134597344-134597366 AGTCTTCACAAGATGGTTTGTGG - Intergenic
964676598 3:159289205-159289227 AGTTCACACTGGGTGCTTTGTGG - Intronic
966401216 3:179549038-179549060 TGTGTTCATTGTATGTTTTGAGG - Intergenic
968447515 4:659320-659342 AGTTTTCACCGGATGTTTAGTGG + Intronic
969911617 4:10452459-10452481 ATTGTTCACTGGGCACTTTGGGG - Intronic
970879294 4:20909506-20909528 AGCATTCACTGGGTGCTTTGGGG - Intronic
972111851 4:35572123-35572145 AGTGTTCTCTGGAAGGTGTGTGG - Intergenic
973035362 4:45398868-45398890 AATTTTCAGTGCATGCTTTGTGG - Intergenic
976434128 4:84997476-84997498 TGTGTACACTGGATGGTTAGTGG + Intergenic
977753596 4:100637981-100638003 AGTGTTTACTGGCTGTTTTGTGG - Intronic
980793114 4:137645493-137645515 AGTGTACACTGTATGTTTTCAGG - Intergenic
980978255 4:139631765-139631787 AGTGTTGAATGGATTCTTTATGG - Intergenic
983219978 4:165034581-165034603 CATGTTTAATGGATGCTTTGGGG - Intronic
983273108 4:165586584-165586606 ACTATGCACTGCATGCTTTGTGG - Intergenic
985763059 5:1761517-1761539 AGGGTGCACAGGAGGCTTTGGGG - Intergenic
990597671 5:57327709-57327731 AGTGTTCACTAGACTCTTGGAGG + Intergenic
990964652 5:61432047-61432069 AATGTTAATTTGATGCTTTGAGG + Intronic
991074504 5:62519805-62519827 ATTCTTCGCTGGAGGCTTTGGGG + Intronic
993583240 5:89690528-89690550 AGTGATCACTCTATGCTCTGAGG - Intergenic
997166339 5:131663602-131663624 ACTGTTTGCTGGATGCTTTAAGG + Intronic
997836121 5:137194745-137194767 AGTGCTCACTGAATGCTCTGGGG - Intronic
998480815 5:142461115-142461137 ACTGTTCACTGGGAGATTTGAGG + Intergenic
999930711 5:156430835-156430857 AGAGTTCACTGTCTTCTTTGGGG + Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001295327 5:170495136-170495158 AGTGTTGCCTGAATGTTTTGGGG + Intronic
1002016293 5:176325797-176325819 AGTGTTCACTAAAGGCTTGGTGG + Intronic
1003534058 6:6960716-6960738 AGTGATCACTGGAGGGTCTGAGG - Intergenic
1004100631 6:12606766-12606788 TGTGCTCACTGGATGATTGGTGG + Intergenic
1004581650 6:16960194-16960216 AGTGTTTACTGAATACTTTTTGG + Intergenic
1005569315 6:27129507-27129529 TGTGTTGACTGGAAGCTTTGGGG - Intronic
1005631405 6:27711637-27711659 AGTGATCATTGGATTCTGTGAGG + Intergenic
1006583525 6:35090302-35090324 AGTCTACTCTGGATGCTTTAGGG - Exonic
1008461256 6:51776244-51776266 AGTTTTCAGTTGATGCTTTAAGG + Intronic
1009406059 6:63314126-63314148 AGGGTTTACTGTATGGTTTGTGG - Intronic
1010112569 6:72256441-72256463 ATTGTTTCCTGGATTCTTTGTGG - Intronic
1010441161 6:75896016-75896038 AATGTTACCTGGATTCTTTGTGG - Intronic
1010671008 6:78686387-78686409 AGTGTTCACTGAATATATTGTGG - Intergenic
1013056259 6:106585977-106585999 AGTGTCCACAGGGTACTTTGTGG - Intronic
1015565167 6:134562751-134562773 AGTGTTCAATAGATGCTTAATGG + Intergenic
1018187656 6:161280927-161280949 AGAATTAACAGGATGCTTTGAGG - Intergenic
1018634054 6:165845216-165845238 GGAGTTCACTGGAAGCTTGGTGG - Intronic
1019382022 7:728744-728766 TGTGCTCACTGGTTGCTGTGGGG + Intronic
1019830344 7:3322034-3322056 ATAGTTCACTCGATGCTGTGTGG - Intronic
1020352046 7:7231426-7231448 AGTGTTAACTGGAACCTTTGAGG - Intronic
1023764242 7:43495909-43495931 TGAGTTCACTGCTTGCTTTGTGG + Intronic
1024331938 7:48163497-48163519 GTTGGTCACTGGTTGCTTTGTGG - Intergenic
1026158091 7:67845145-67845167 AGTATTTACTGGATGCTTTGAGG + Intergenic
1027369745 7:77495426-77495448 AAGGATCACTGGATGCTCTGTGG + Intergenic
1029935193 7:104417056-104417078 AGTTTCCAATGCATGCTTTGTGG + Intronic
1031879269 7:127177581-127177603 GGTGTTCAATGGATTCTGTGAGG - Intronic
1032879097 7:136069570-136069592 ATTGTTCCCAGGATGCTTTCTGG + Intergenic
1033730813 7:144177304-144177326 GATGTTAACTGGTTGCTTTGTGG + Intergenic
1034521919 7:151627033-151627055 AGTGATTATTGGTTGCTTTGGGG + Intronic
1035745091 8:1956090-1956112 CGTGTCTTCTGGATGCTTTGTGG - Intronic
1041786636 8:61641493-61641515 TGTGTTCACAGGAAGATTTGGGG - Intronic
1042210277 8:66373116-66373138 AGGCTTCACTGGCTGCTATGTGG + Intergenic
1042259835 8:66846980-66847002 AGTGTTCACTGAATGAATTAGGG - Intronic
1042485166 8:69339590-69339612 AGTGTTGAGTGGATGCTTCTAGG - Intergenic
1042910169 8:73818137-73818159 AGTGTGAATTGTATGCTTTGGGG - Intronic
1043587756 8:81789002-81789024 AATGTCCAGTGCATGCTTTGTGG + Intergenic
1043672727 8:82908190-82908212 AGTCTTCATTGAAGGCTTTGTGG - Intergenic
1043977573 8:86600223-86600245 AGTGTGTACAGGATGCTTTGGGG - Intronic
1044462295 8:92459556-92459578 ATGGTTCATTGTATGCTTTGGGG + Intergenic
1047211177 8:122841629-122841651 ATTGTTCTCTGATTGCTTTGAGG + Intronic
1047453483 8:124988202-124988224 AGTGACCACAGGATGGTTTGGGG - Intergenic
1048183676 8:132219178-132219200 AGTGTGCACTGGAATCCTTGGGG + Intronic
1048421424 8:134281985-134282007 AGTGTACACTAGATACTTAGGGG + Intergenic
1048531308 8:135252908-135252930 AGTGTTCACTCATTGCCTTGGGG - Intergenic
1049344297 8:142130284-142130306 AGTGCTCCCTGGAAGCTGTGGGG - Intergenic
1049344335 8:142130411-142130433 AGTGCTCCCTGGAAGCTGTGGGG - Intergenic
1052204702 9:25825947-25825969 ACTTTTCACTTGATGCTTTTAGG + Intergenic
1054878606 9:70122268-70122290 TGTGTTTTCTGGATGCTTTTTGG + Intronic
1055795181 9:79968170-79968192 AGTGGTCTCTGGAAGCTATGAGG - Intergenic
1056334651 9:85555261-85555283 AGTCTTGTCTGGATGCTTTTAGG - Intronic
1056345896 9:85694475-85694497 AGTGACCACAGGATGCTTTTGGG - Intronic
1057184194 9:93047477-93047499 AGTCTGCACTGGATGCTATCGGG + Intergenic
1057457400 9:95227065-95227087 AGTGTTCAGGGAGTGCTTTGGGG - Intronic
1057476435 9:95406917-95406939 AGTGGTCACAGGAGGCTTAGGGG - Intergenic
1057592517 9:96384446-96384468 GGTGTCCTCTGGGTGCTTTGTGG + Intergenic
1059991847 9:119872900-119872922 AGGGTTCACAGGAGACTTTGTGG + Intergenic
1060240894 9:121902170-121902192 AGTGTTCACTGGTTGCTTCTGGG - Intronic
1061778725 9:132983549-132983571 GGTGTTCACCGGGTGCTGTGAGG + Intronic
1186834381 X:13422836-13422858 TGTGCTCACTTGATGTTTTGGGG - Intergenic
1187651863 X:21418691-21418713 TGTGTTCTCTTGTTGCTTTGAGG + Intronic
1188060957 X:25601274-25601296 ATAGTTCACTAGAAGCTTTGTGG + Intergenic
1191957371 X:66658874-66658896 TGTGTTCACTGTATGATTTTTGG - Intergenic
1192037918 X:67585775-67585797 AGTGTTCACTGGTTGTGTTATGG - Intronic
1193424047 X:81319164-81319186 AGTAAACACTGGATGCTTGGAGG + Intergenic
1193978609 X:88154336-88154358 AATGGTCACTGCATGCTGTGTGG - Intergenic
1194595380 X:95850626-95850648 TGTGTTTTCTGGTTGCTTTGTGG - Intergenic
1194714292 X:97272811-97272833 AGTATTCACTGCATACATTGGGG + Intronic
1197405565 X:126043824-126043846 TGTATTCTCTGGGTGCTTTGTGG + Intergenic
1197476821 X:126935374-126935396 AGTGATCACTTGTTGCTTTTGGG + Intergenic
1199662197 X:150063258-150063280 GTAGTTCACTGGATACTTTGAGG - Intergenic
1200032833 X:153310330-153310352 GGTGTTATCTGGAGGCTTTGGGG + Intergenic