ID: 1082778747

View in Genome Browser
Species Human (GRCh38)
Location 11:57269756-57269778
Sequence CCTGAAAGGCAGACAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082778747_1082778755 -6 Left 1082778747 11:57269756-57269778 CCAGCCTCTGTCTGCCTTTCAGG No data
Right 1082778755 11:57269773-57269795 TTCAGGGGGAGCAGAGCTCAGGG No data
1082778747_1082778761 16 Left 1082778747 11:57269756-57269778 CCAGCCTCTGTCTGCCTTTCAGG No data
Right 1082778761 11:57269795-57269817 GCCTGGGAATGGAGGGAGCAAGG No data
1082778747_1082778760 9 Left 1082778747 11:57269756-57269778 CCAGCCTCTGTCTGCCTTTCAGG No data
Right 1082778760 11:57269788-57269810 GCTCAGGGCCTGGGAATGGAGGG No data
1082778747_1082778759 8 Left 1082778747 11:57269756-57269778 CCAGCCTCTGTCTGCCTTTCAGG No data
Right 1082778759 11:57269787-57269809 AGCTCAGGGCCTGGGAATGGAGG No data
1082778747_1082778757 0 Left 1082778747 11:57269756-57269778 CCAGCCTCTGTCTGCCTTTCAGG No data
Right 1082778757 11:57269779-57269801 GGGAGCAGAGCTCAGGGCCTGGG No data
1082778747_1082778756 -1 Left 1082778747 11:57269756-57269778 CCAGCCTCTGTCTGCCTTTCAGG No data
Right 1082778756 11:57269778-57269800 GGGGAGCAGAGCTCAGGGCCTGG No data
1082778747_1082778758 5 Left 1082778747 11:57269756-57269778 CCAGCCTCTGTCTGCCTTTCAGG No data
Right 1082778758 11:57269784-57269806 CAGAGCTCAGGGCCTGGGAATGG No data
1082778747_1082778754 -7 Left 1082778747 11:57269756-57269778 CCAGCCTCTGTCTGCCTTTCAGG No data
Right 1082778754 11:57269772-57269794 TTTCAGGGGGAGCAGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082778747 Original CRISPR CCTGAAAGGCAGACAGAGGC TGG (reversed) Intergenic
No off target data available for this crispr