ID: 1082783318

View in Genome Browser
Species Human (GRCh38)
Location 11:57302930-57302952
Sequence TGGAAAAAGCATGGGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 801
Summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 734}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082783318_1082783330 22 Left 1082783318 11:57302930-57302952 CCCTCCTTCCCATGCTTTTTCCA 0: 1
1: 0
2: 7
3: 59
4: 734
Right 1082783330 11:57302975-57302997 CCTTGAGCAACACAGCACACAGG 0: 1
1: 0
2: 1
3: 14
4: 239
1082783318_1082783324 -7 Left 1082783318 11:57302930-57302952 CCCTCCTTCCCATGCTTTTTCCA 0: 1
1: 0
2: 7
3: 59
4: 734
Right 1082783324 11:57302946-57302968 TTTTCCAGACTCCAAGGACACGG 0: 1
1: 0
2: 2
3: 26
4: 281
1082783318_1082783326 -2 Left 1082783318 11:57302930-57302952 CCCTCCTTCCCATGCTTTTTCCA 0: 1
1: 0
2: 7
3: 59
4: 734
Right 1082783326 11:57302951-57302973 CAGACTCCAAGGACACGGTCAGG 0: 1
1: 0
2: 1
3: 4
4: 89
1082783318_1082783327 -1 Left 1082783318 11:57302930-57302952 CCCTCCTTCCCATGCTTTTTCCA 0: 1
1: 0
2: 7
3: 59
4: 734
Right 1082783327 11:57302952-57302974 AGACTCCAAGGACACGGTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082783318 Original CRISPR TGGAAAAAGCATGGGAAGGA GGG (reversed) Intronic
900073716 1:794679-794701 TGGAAGGAGAATTGGAAGGAAGG - Intergenic
900498215 1:2986355-2986377 TGGAAAGAGGAAAGGAAGGAAGG - Intergenic
900568073 1:3345018-3345040 GGGAGAAACCATGGAAAGGAAGG - Intronic
900681670 1:3920116-3920138 GGGAAGAAGGAAGGGAAGGAAGG - Intergenic
900756060 1:4435685-4435707 TGGCAAATGCAGGGGGAGGAGGG - Intergenic
902700830 1:18170786-18170808 TGGAAGAATCATGGACAGGAGGG - Intronic
902926417 1:19698703-19698725 AGGAAGAAGAAAGGGAAGGAGGG - Intronic
903482544 1:23664546-23664568 TGGAAAAGGCTTTGGAAGGAGGG + Intergenic
903676575 1:25068198-25068220 TGGAAAAAAAATTGGAAGAAAGG - Intergenic
903767609 1:25744639-25744661 TGGAAAAAGAATGGAAGTGAGGG - Intronic
904246443 1:29191545-29191567 TGAAAAAAGCCTTAGAAGGAGGG - Intergenic
904382904 1:30123550-30123572 TGGAAGAAAGAAGGGAAGGAAGG + Intergenic
904535530 1:31197058-31197080 TGGAAAAAATAAAGGAAGGAGGG - Intronic
905532533 1:38693451-38693473 TGGGAAAACCAGGGAAAGGAGGG + Intergenic
905589190 1:39147321-39147343 AGGAAAAAGAAAAGGAAGGAAGG - Intronic
905607290 1:39313568-39313590 AGAAGAAAGCAAGGGAAGGAGGG - Intronic
906385291 1:45363343-45363365 TGGAAAATGGATTGGAATGAGGG - Intronic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
906649962 1:47505919-47505941 TTGAAAGGGCAGGGGAAGGAAGG + Intergenic
906911113 1:49951943-49951965 AGGAAGAAGCGAGGGAAGGAGGG + Intronic
906949632 1:50323718-50323740 TGGAATGAGCATGGGAAGACAGG - Intergenic
907336912 1:53705751-53705773 TGGAAACAGCTTGGGATGGAAGG - Intronic
907946492 1:59140649-59140671 TGGAAAGAGCCAGGGAAGGTGGG + Intergenic
908376459 1:63547041-63547063 GGGAAAAAGAATGGGGAGGTGGG - Intronic
908508268 1:64827823-64827845 TGTAAAAAGTATGGCAATGAAGG - Intronic
908903668 1:68984235-68984257 GGGAAGAAGGATGGGAAGGAAGG - Intergenic
909346275 1:74591260-74591282 TAGCAGAAGCAAGGGAAGGAAGG + Intronic
909899124 1:81110599-81110621 TGGATAAAACATGAGAAGGCTGG - Intergenic
910093251 1:83490665-83490687 TGGACAAAGCAAGAGAAAGAAGG - Intergenic
910287269 1:85569647-85569669 TGGAAAAAGCATTTGCAGGATGG + Intronic
910287339 1:85570300-85570322 TGGAATAAGCAAGGGAGAGAAGG - Intronic
910591716 1:88933399-88933421 GGGAAAAAATAGGGGAAGGAGGG + Intergenic
910869186 1:91816142-91816164 TGGAGAAAGCAACAGAAGGATGG + Intronic
911090612 1:94014257-94014279 AGGAAAGAGGAAGGGAAGGAGGG + Intronic
911124015 1:94323448-94323470 TGGAAAAAGTGAAGGAAGGAGGG - Intergenic
911632813 1:100201351-100201373 AGAAAAAAGAATGAGAAGGAAGG + Intronic
912049129 1:105501696-105501718 TGGAAAGAGCTGGGTAAGGAAGG - Intergenic
912572746 1:110636578-110636600 TGGAAAATGGCTGGCAAGGAGGG + Intergenic
912630931 1:111246279-111246301 AGTCAAAAGCCTGGGAAGGATGG + Intergenic
913216600 1:116626186-116626208 TGGAAAAATGAGGGGAAGCAGGG - Intronic
914456003 1:147837040-147837062 TGGAGAAATCATGGTAATGAGGG + Intergenic
914720050 1:150282243-150282265 TGGAAAAAGAGTGGAAAAGAAGG - Intergenic
915612610 1:157006638-157006660 TGGTAACAGCATGGGAAGTCAGG + Intronic
915976742 1:160396151-160396173 TAGAAAACACATTGGAAGGATGG + Intergenic
915983579 1:160440313-160440335 AAGAAAAAGCAAGAGAAGGAAGG - Intergenic
916283002 1:163073322-163073344 TGAAAAAAGCAGGGGAAAAAGGG + Intronic
916558080 1:165910168-165910190 TGGAACAAGGAAGGGATGGAAGG + Intronic
917416897 1:174819903-174819925 GGGAATAGGCAAGGGAAGGATGG + Intronic
917605836 1:176628201-176628223 TAGAGAAAGCAAGGGCAGGAGGG + Intronic
917940748 1:179918776-179918798 TGGAAAGAACAAGGCAAGGAAGG + Exonic
918209864 1:182341017-182341039 TGGAAAAAGACTTGAAAGGAAGG - Intergenic
918235994 1:182581396-182581418 TGGAAAAGGAAAGGGAGGGATGG - Intronic
918443659 1:184594709-184594731 TGGAAACAGCAGGTGCAGGAGGG - Intronic
919067883 1:192715368-192715390 AGGAGAAAGCAAGGGATGGATGG + Intergenic
919846003 1:201642610-201642632 AGGAAAAGGAAAGGGAAGGAAGG - Intronic
919927232 1:202198526-202198548 TGGAGCTAGCATGGGAGGGAGGG + Intronic
920363955 1:205438359-205438381 TGGAGAGAGGATGGGAAGGCAGG + Intronic
920796623 1:209143435-209143457 GGGAAAAAGAAAGGAAAGGAGGG + Intergenic
920916596 1:210262581-210262603 TGGAAAAATGAGGAGAAGGAAGG - Intergenic
922188645 1:223297859-223297881 AGGATAAAGCAAGGGATGGATGG + Intronic
922204667 1:223436056-223436078 AGGAAAAAGCAGGAGAAGGGAGG + Intergenic
922269575 1:224019586-224019608 TGGAAGGAGAATTGGAAGGAAGG - Intergenic
922400885 1:225254138-225254160 TGGAAAGTGCAGGGTAAGGACGG + Intronic
922447690 1:225711357-225711379 TGGAAAAGGCAGAGTAAGGAGGG + Intergenic
922547294 1:226467383-226467405 AGGAGAATGGATGGGAAGGAGGG + Intergenic
922741262 1:228015586-228015608 TGGGAACAGCAGGGGCAGGAAGG - Intronic
922812818 1:228427163-228427185 TGAAAAAAGGAGGGAAAGGAGGG - Intergenic
923067786 1:230535874-230535896 TGGAAAATGGCTGGGAAGAAAGG - Intergenic
923097289 1:230785548-230785570 TGGAAAAAGCAGGAGCAGGGTGG - Intronic
923127742 1:231047231-231047253 GGGAAGGAGCAAGGGAAGGAAGG - Intergenic
923338130 1:232987136-232987158 TGAGAAGAGCATGGGAAGCAAGG - Intronic
923438149 1:233988580-233988602 TGGAAAGAGCATGTGGAGGGTGG - Intronic
923448480 1:234094550-234094572 TGGAAACAGCATGTGATTGATGG + Intronic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
923988873 1:239412205-239412227 GAGAAAAAGAGTGGGAAGGAGGG - Intronic
924574859 1:245270312-245270334 AGGAAAAAGGAAGTGAAGGAGGG - Intronic
924740908 1:246793936-246793958 GGCAAGAAGCATGGGAAGGGCGG + Intergenic
1062980364 10:1717532-1717554 AGGAAAAAGGAAAGGAAGGAAGG - Intronic
1063914901 10:10871586-10871608 GGGAAAAAGAATGGAAAAGAGGG + Intergenic
1064276289 10:13908289-13908311 AGGAAAAAGGATGAGAAGCATGG - Intronic
1064485414 10:15783482-15783504 TGGAAAAAGGAAGGAGAGGAGGG - Intronic
1064490796 10:15854276-15854298 TGGAAAAGGCATGAGAAGTATGG - Intronic
1064849959 10:19699274-19699296 TGGAGAAAGGAGGGAAAGGAGGG + Intronic
1065065437 10:21958940-21958962 TGGTAAAAGGAAGAGAAGGAAGG - Intronic
1065258487 10:23899986-23900008 GGAAAAAAGAAAGGGAAGGAGGG - Intronic
1065809832 10:29431154-29431176 GGAAAAAAGGAAGGGAAGGAGGG - Intergenic
1065933554 10:30500207-30500229 GGGAGAAAGCAAGGGAAGGAGGG + Intergenic
1066108666 10:32177652-32177674 TGGGAAAAGCAGGGGCAGGCAGG - Intergenic
1066256057 10:33679788-33679810 AGGAAAATGCAGGGGAAGGGAGG + Intergenic
1066479749 10:35784355-35784377 GGAAGAAAGGATGGGAAGGAAGG - Intergenic
1066494644 10:35930791-35930813 TGGAAAAAGCAGAGCAAGGGAGG + Intergenic
1067215701 10:44300805-44300827 TGGAAACACCGTGGGAAGGCTGG - Intergenic
1067276409 10:44838821-44838843 TGGAAAAGACAAGGGAAGGCCGG - Intergenic
1067411405 10:46068040-46068062 TAGAAAAAGGATATGAAGGAGGG + Intergenic
1067467419 10:46511258-46511280 TGGGAAAAACAAGGCAAGGAAGG + Intergenic
1067619767 10:47873347-47873369 TGGGAAAAACAAGGCAAGGAAGG - Intergenic
1067807885 10:49405828-49405850 GGGAAAGAGGAAGGGAAGGAGGG - Intergenic
1068309667 10:55262042-55262064 GGGAAAAAGGAAGGGAGGGAGGG + Intronic
1068321846 10:55428867-55428889 TGGAAAAATAATGGGAAAAACGG - Intronic
1068728668 10:60331653-60331675 TGAAAGAAGGATGGGCAGGAAGG - Intronic
1068766325 10:60767936-60767958 TGTTAAAAGGAAGGGAAGGAAGG - Intergenic
1069108707 10:64415951-64415973 GGGAAAAAGAGAGGGAAGGAAGG - Intergenic
1069226318 10:65949572-65949594 AGAAAAAAGCATGGGGAGGTAGG + Intronic
1069533124 10:69233538-69233560 TAGAAGAAACATGGGAAGGCTGG + Intronic
1069543964 10:69316092-69316114 TGGAGAAGGCAGGGCAAGGAAGG + Intronic
1069737969 10:70670014-70670036 TGGCACGAGCATGGGCAGGAGGG - Intergenic
1069777646 10:70936214-70936236 AGGAAAAAGCCTGGGAAGGGTGG - Intergenic
1070191598 10:74116404-74116426 TGGAAAAAAATGGGGAAGGAAGG + Intronic
1070305432 10:75236220-75236242 AGAAAAAAGCATTGGCAGGAGGG - Intergenic
1070392041 10:75979717-75979739 GGGAAGAAACATGGGGAGGAGGG - Intronic
1070752918 10:78974324-78974346 TGAAAACAGCCTGGGAGGGAGGG + Intergenic
1070803333 10:79256102-79256124 AGGGAAAATCATGGGGAGGAAGG - Intronic
1070889477 10:79931285-79931307 GAGCAAAAGCAAGGGAAGGATGG + Intergenic
1071468453 10:85961724-85961746 TAGAAGGAGGATGGGAAGGAAGG - Intronic
1071536802 10:86440129-86440151 AGGAATTAGCATGGGAAAGATGG + Intronic
1071766542 10:88672350-88672372 TGGAAAGAGGAGGGAAAGGAAGG + Intronic
1071771719 10:88736138-88736160 GGGAAAAAGGAAGGGAAGGAGGG + Intronic
1071954338 10:90741592-90741614 TGGAAGAAGTGTGGGAATGATGG - Exonic
1072004611 10:91232374-91232396 TGAAAAAAGAATGGGAAGAGAGG + Intronic
1072280841 10:93863853-93863875 AGGATAAAGAATGGGAAGAAGGG - Intergenic
1072303186 10:94082152-94082174 TGGAGAGAGGCTGGGAAGGAAGG - Intronic
1072451022 10:95539816-95539838 TGGAAAGAGCATAGGAAGGAGGG - Intronic
1072738607 10:97896189-97896211 TGCAAAGACCAGGGGAAGGAAGG - Intronic
1072810239 10:98455924-98455946 TGGAAAAGGCAAGAGAAGAAAGG - Intergenic
1072889077 10:99305534-99305556 AGGAAAAAACAAAGGAAGGAAGG + Intergenic
1073846431 10:107560979-107561001 CGGAAAAAGCATGAAAAGGTAGG - Intergenic
1073978782 10:109130499-109130521 TGGAAAAAAAAGGGGAAGGCAGG - Intergenic
1073998776 10:109346110-109346132 TGGAACAAGGAAGGGAAGGCTGG + Intergenic
1074006033 10:109424543-109424565 GGGAAGAAGAAAGGGAAGGAAGG + Intergenic
1074094720 10:110301242-110301264 AGGAAAAAGGAGGGGAATGAGGG + Intronic
1074197912 10:111205612-111205634 TGGAAAAATCAGAAGAAGGAAGG - Intergenic
1074721627 10:116270610-116270632 TGGAAAACCCATGAGGAGGACGG - Intronic
1074844538 10:117385691-117385713 AGGAGACAGCTTGGGAAGGATGG - Intergenic
1075087474 10:119423142-119423164 TGGAAGAAGGAAGGGAAGGGAGG - Intronic
1075114367 10:119613513-119613535 TGGAGAATGCATTGAAAGGAGGG - Intergenic
1075226285 10:120632497-120632519 TGGACAGAGGATGGGATGGATGG + Intergenic
1075282633 10:121153541-121153563 TGGAGAAAACATGAGAAGAATGG + Intergenic
1075923718 10:126234167-126234189 AAGAAAAAAGATGGGAAGGAAGG + Intronic
1076063020 10:127428353-127428375 TGGAGAAAGCAAGGGCAGGAAGG + Intronic
1076083810 10:127607298-127607320 AGGATAAAGCAAGGGCAGGAGGG - Intergenic
1076456356 10:130601477-130601499 TGCAATAAGCATTGGAATGAAGG + Intergenic
1076544687 10:131237289-131237311 TGGACAGAGCAGGGGAGGGAGGG - Intronic
1076896088 10:133312973-133312995 AGGAACAAGGATGGGGAGGATGG - Exonic
1078108146 11:8371552-8371574 GGGAGAAAGCATGGGAGGAAGGG + Intergenic
1078481966 11:11685108-11685130 AGGAAAAAGGGAGGGAAGGAAGG + Intergenic
1078850966 11:15163320-15163342 AGGGAAAAGAATGAGAAGGAAGG - Intronic
1079680889 11:23296468-23296490 TGGAAAATGCATGGGTAGGGAGG + Intergenic
1079754586 11:24240319-24240341 GGGAGCAAGCATGAGAAGGAGGG + Intergenic
1080572282 11:33567198-33567220 TGGAAAAAGGATGGGCAAGAAGG + Intronic
1080739462 11:35049957-35049979 TGAGAATAGCATGGGAAAGATGG - Intergenic
1081239325 11:40683566-40683588 AGGAAAAAGGAGGGGATGGAAGG + Intronic
1081368830 11:42272878-42272900 AGGAAAACGCATGGGCATGAAGG + Intergenic
1081686409 11:45046329-45046351 TGGAAAGAGAAAGGTAAGGAGGG + Intergenic
1082013648 11:47468135-47468157 TGGAACAAGCATGGGGCTGAGGG + Intronic
1082783318 11:57302930-57302952 TGGAAAAAGCATGGGAAGGAGGG - Intronic
1084453220 11:69252207-69252229 TGAAAATAGCATGGGGAGGGAGG - Intergenic
1084670929 11:70606208-70606230 TGGAAAAGGTGGGGGAAGGATGG - Intronic
1085152634 11:74264440-74264462 TGGAAGTTTCATGGGAAGGAGGG - Intronic
1085224788 11:74909894-74909916 TAGAAGATGCATGGGAAGGGTGG + Intronic
1085263168 11:75220006-75220028 TGGAAAGAGTAAGGGAGGGAAGG - Intergenic
1085637621 11:78170567-78170589 TGGCAAAAGCATGAGAAAGACGG - Intergenic
1085812553 11:79697832-79697854 GAGAAAAAGTATGGAAAGGAAGG + Intergenic
1086284713 11:85233615-85233637 TGGCAAGATAATGGGAAGGAGGG + Intronic
1086335797 11:85799623-85799645 GGGAAATAGCATGGCAAGCATGG - Intronic
1086609251 11:88734488-88734510 TGCAAAAAACATGGGAGGGTGGG - Intronic
1086783893 11:90940895-90940917 AGGAAAAAGGAAGGAAAGGAAGG + Intergenic
1087022892 11:93621097-93621119 AGAAAACAGCATGGGAAGGATGG - Intergenic
1087578488 11:100021976-100021998 TGGAAAAAGCAGGGAGAAGAAGG - Intronic
1088546279 11:110962601-110962623 GGGGAAAAGAATGGGAAGAAGGG - Intergenic
1088763369 11:112952853-112952875 TAGAAAAAGCAAGGGGAGGAGGG - Intergenic
1088973617 11:114795218-114795240 TGGAGAAGGGATGTGAAGGAAGG + Intergenic
1089003273 11:115069536-115069558 GGGAGAAAGCATGAGAAGGCTGG - Intergenic
1089033104 11:115354454-115354476 TGGACAAGGCAGGGCAAGGAAGG + Intronic
1089209945 11:116792898-116792920 TGGAACAAGCAAGGGAAGCCAGG + Intergenic
1089268576 11:117285029-117285051 TGGAAAAACAAAGGGAAGGAAGG - Intronic
1089315957 11:117591715-117591737 TGACAGAAGCATGGGAAAGAGGG - Intronic
1089483000 11:118822287-118822309 TGGAAAAGACAAGAGAAGGAGGG - Intergenic
1089507711 11:118975204-118975226 TGGAAAAAGCCTTTCAAGGAGGG + Intronic
1089730467 11:120515826-120515848 TGGGTAAATTATGGGAAGGAAGG + Intronic
1089836194 11:121372762-121372784 TGGAACATGCAGGAGAAGGAGGG + Intergenic
1090093788 11:123724296-123724318 TGGAAAAGGAATGGGTAAGATGG + Exonic
1090191723 11:124775369-124775391 TGGAAAAAGTGAGGGAAGGGAGG + Intronic
1090260601 11:125316042-125316064 TGACAACAGCAAGGGAAGGATGG + Intronic
1090386719 11:126361602-126361624 TGGAGAACGCAGGGGGAGGAAGG - Intronic
1090911315 11:131122010-131122032 CAGAAACAGCAGGGGAAGGATGG + Intergenic
1091785148 12:3238883-3238905 AGGAAACAGCTTGGGAATGAAGG - Intronic
1091858680 12:3759424-3759446 AGGAAAAAGGAAGGGAGGGAGGG + Intronic
1092481241 12:8860985-8861007 AGGAATACGCATGAGAAGGAGGG - Intronic
1092579471 12:9822456-9822478 AGGAAAAAGAATGAAAAGGAAGG + Intergenic
1092795650 12:12108010-12108032 TGGAAAGAGGGTGGGAAGGTCGG + Intronic
1093017666 12:14171019-14171041 AGGGAAAAGGAAGGGAAGGAAGG + Intergenic
1094630402 12:32168462-32168484 TGGGAAAAGGATGGGAGGGTGGG + Intronic
1094743038 12:33311101-33311123 TGGAAAAAGCATAGTAAACAAGG + Intergenic
1095310116 12:40688649-40688671 TGGAAAAAGGAGGGGAAGACAGG + Intergenic
1095610136 12:44118378-44118400 TTTAGAAAGCAGGGGAAGGATGG + Intronic
1095686098 12:45035677-45035699 AGGAAAAAGGAAAGGAAGGAAGG - Intronic
1095774459 12:45996976-45996998 TAGAAAAAGCATTGAAAGAAAGG - Intergenic
1096308349 12:50498706-50498728 TGGAACACCCATGGGAATGAGGG - Intergenic
1096495104 12:52035473-52035495 TGGAAAAAGAAAGGAAAAGAGGG + Intronic
1096533320 12:52255445-52255467 AGGAAAAAAAATGGGAATGAAGG + Intronic
1096849192 12:54424671-54424693 TGGAAAGAGGTTGGGGAGGAAGG + Intergenic
1097475005 12:60042657-60042679 GGAAAAAAGAAAGGGAAGGAAGG + Intergenic
1097926741 12:65136350-65136372 TGGAAAAAGGGAGGGCAGGAAGG + Intergenic
1098394273 12:70002022-70002044 TGGAAAAAGAAAAGGCAGGATGG - Intergenic
1098769371 12:74534611-74534633 TGGAGAAAGCATGAGAAAGAAGG + Intergenic
1099369566 12:81812511-81812533 AGGAAAAAGCAAGGCAACGAGGG + Intergenic
1099834255 12:87887393-87887415 TGGAAGAAGGGTTGGAAGGAGGG - Intergenic
1100122770 12:91388164-91388186 TGGAAAGGGGATGGGGAGGATGG + Intergenic
1100137070 12:91566824-91566846 AGGAAAAAGGAAGGGAAAGAAGG - Intergenic
1100382242 12:94072765-94072787 TAGAGAAAGCATGGGAATTAAGG + Intergenic
1101086644 12:101243007-101243029 GGGAAAAAGCAGGGGGTGGAGGG + Intergenic
1101090187 12:101277152-101277174 TGGAAAAAGGATATAAAGGATGG + Intergenic
1101255539 12:102973515-102973537 TGAAGAAAGGAAGGGAAGGAAGG - Intergenic
1101374182 12:104156679-104156701 TGGACAAGGGATGGGAGGGATGG + Intergenic
1101626805 12:106451760-106451782 ATGAAAAAGCTTGGTAAGGAAGG - Intronic
1101662494 12:106778181-106778203 TAGAAAAAGAAGGGGAAGAATGG - Intronic
1101960834 12:109248632-109248654 TAGAAAAAGCAGGTGAAAGAAGG - Intronic
1102239876 12:111318384-111318406 TGAAAAAAGCAGGTGAAGGCTGG - Intronic
1102258319 12:111428798-111428820 TGGAAGAATCACGGCAAGGACGG - Intronic
1102550644 12:113689386-113689408 TGGACAGAGCTTGGTAAGGACGG - Intergenic
1102830098 12:115990274-115990296 TGATAAAAGCATGGGATAGACGG - Intronic
1102991947 12:117322124-117322146 AGGAAAAAGAGAGGGAAGGAAGG - Intronic
1103028870 12:117596028-117596050 GGGAAAAAGGAAGGGAGGGAGGG - Intronic
1103586661 12:121961286-121961308 GGGAAGAAGAAAGGGAAGGAAGG - Intronic
1104378799 12:128288854-128288876 TGGGGAAATCAAGGGAAGGAGGG - Intronic
1104551632 12:129762449-129762471 TTGAAACATCATGGGAATGATGG - Intronic
1104891618 12:132142943-132142965 TGGAAAAAGCTAGGGGAGGGAGG + Intronic
1104996573 12:132661562-132661584 TGGAAGAATCATGGCAAGGTAGG + Exonic
1105444109 13:20437641-20437663 TGGAAAAAGAGTAGGAAGGAGGG + Intronic
1105577468 13:21667661-21667683 TGTAAGGAGCATGGGATGGAGGG - Intergenic
1105722478 13:23130756-23130778 TGGAAAAGGCGTGGGGAGAAAGG - Intergenic
1106077580 13:26474626-26474648 TGGAAAAAGAATGGGAGGTTGGG + Intergenic
1106777075 13:33018668-33018690 TAGAAAAACTATGGGAAGAATGG + Intronic
1107916640 13:45158493-45158515 TGGAAAAAGGCTGGGGATGATGG - Intronic
1108260737 13:48653218-48653240 AGGTAAAAGCAAGAGAAGGAGGG + Intergenic
1108273568 13:48786281-48786303 TGTAAAAATAATGAGAAGGAGGG + Intergenic
1108414805 13:50186540-50186562 GGAAAAAAGCATGGAAAAGAAGG - Intronic
1108455974 13:50613929-50613951 TAGATAATGCATGTGAAGGAAGG + Intronic
1109157415 13:58927966-58927988 AGGAAGAAGCAAGGGAGGGAAGG + Intergenic
1109250365 13:60012428-60012450 TGGAAAAAGAATGAAAAGGCAGG + Intronic
1109275358 13:60298226-60298248 TGAAGAAAGCATTGGAAGAAAGG - Intergenic
1109322112 13:60823564-60823586 TGCAAAAAGGATGGGCAGGTGGG + Intergenic
1110004713 13:70251405-70251427 GGGAAGAATCATGGGAAAGAGGG + Intergenic
1110309359 13:74029896-74029918 GTGAAAAAGTATGGAAAGGAAGG + Intronic
1111090399 13:83438877-83438899 TGGAAAAAGGACTGGAAGGATGG - Intergenic
1112984716 13:105434260-105434282 TAGAACAAACATGGAAAGGAAGG - Intergenic
1113307130 13:109090675-109090697 TGTCAGAATCATGGGAAGGAGGG + Intronic
1114275066 14:21135643-21135665 TGGGAAGAGCAGGGGAAGGTAGG - Intergenic
1114327817 14:21607076-21607098 TTGAGAGAGCATGGTAAGGAAGG + Intergenic
1114820713 14:26015978-26016000 TGGAAAAAACATGGGAGTGCAGG - Intergenic
1115081866 14:29463001-29463023 AGGAAAAGGCAGAGGAAGGAGGG + Intergenic
1115119824 14:29926967-29926989 TGGAAATGTCATGAGAAGGATGG + Intronic
1115319611 14:32065051-32065073 TGGAAACAGTATATGAAGGAGGG + Intergenic
1115976567 14:39003258-39003280 TGTGAAAAACATGGTAAGGAGGG + Intergenic
1116879802 14:50154116-50154138 GGGAAAAGGAAAGGGAAGGAAGG + Intronic
1117575323 14:57091849-57091871 TGGAGAAAGAATGGAAAGAAAGG + Intergenic
1118388151 14:65273908-65273930 AGGAAAAAGCGAAGGAAGGAAGG + Intergenic
1118558377 14:67051331-67051353 TGGATAGACCAAGGGAAGGAAGG + Intronic
1118935654 14:70285414-70285436 TGAAGAAAGAATGGGAAGTAAGG - Intergenic
1119406299 14:74401678-74401700 CGGAAACAGCCGGGGAAGGAAGG + Intergenic
1119417818 14:74486246-74486268 TGGAATAAGCATGGGAATGGAGG - Intronic
1120503086 14:85321493-85321515 TGAAAAAAGAGGGGGAAGGAAGG + Intergenic
1120513941 14:85448258-85448280 TGGAAAATGCTTGGAAAGGATGG - Intergenic
1121118877 14:91363405-91363427 TGGAAAAAGAATGCAAAGGCCGG - Intronic
1121583964 14:95050238-95050260 AGGAAGAAGGAAGGGAAGGAAGG + Intergenic
1121659490 14:95624304-95624326 GGGAGAAAGAATGGGAAGGCAGG + Intergenic
1122048180 14:99038114-99038136 TGTAAGAAGCAGGGCAAGGATGG + Intergenic
1122373108 14:101240158-101240180 CGGAAAAAGCATGGGTGGAAAGG + Intergenic
1122405724 14:101499662-101499684 TGGAACGCGCATGGGATGGAGGG + Intergenic
1122589122 14:102833451-102833473 AGGGAAAAGCAAAGGAAGGAAGG - Intronic
1123443778 15:20307065-20307087 TGGAAAAAACATGGCCAGGGAGG - Intergenic
1123963373 15:25430886-25430908 GGGAATAAGAATGGGAAGGTGGG + Intronic
1124168011 15:27346326-27346348 TGGAAAAAGCTGGGGAATGAAGG - Intronic
1124455808 15:29841719-29841741 AGGAAAAAGGAGGGGAGGGAGGG - Intronic
1124572709 15:30880487-30880509 TGGAAAATGAAGGGGAAGAAAGG + Intergenic
1125104641 15:35956297-35956319 TGGAAAAAAGCGGGGAAGGAGGG - Intergenic
1125339524 15:38661075-38661097 GGGAAAAAGGAAGGGAGGGAGGG - Intergenic
1125886585 15:43234243-43234265 GGGAGACAGCACGGGAAGGAAGG + Intronic
1125998853 15:44190252-44190274 TAGAAACAGGATGGGAAGCATGG + Intronic
1126370542 15:47941246-47941268 TGGAAGAAGGAAAGGAAGGAAGG + Intergenic
1126975828 15:54178927-54178949 TGGAAATAGCATGGAATGGAAGG + Intronic
1127013407 15:54655465-54655487 GGGAGAAGGCAAGGGAAGGAAGG + Intergenic
1127537561 15:59904255-59904277 TGGAAAGAAGAAGGGAAGGAAGG + Intergenic
1127567458 15:60205815-60205837 TGGAAAGAGCATGGGGCAGAGGG - Intergenic
1127576664 15:60298416-60298438 TGGAATATGGAGGGGAAGGAGGG + Intergenic
1127689969 15:61385868-61385890 TGTAAAAAGGATGGGAGGGAGGG - Intergenic
1127771918 15:62239171-62239193 GGGACAAAGCATGGAGAGGAGGG + Intergenic
1127829008 15:62733331-62733353 TGGAGAATGGATGGGAAGCAAGG + Intronic
1127984213 15:64056716-64056738 GGGAAAAAGCAATAGAAGGAAGG + Intronic
1128231636 15:66039638-66039660 TGGAGAAAGCAGGGGTGGGAGGG - Intronic
1128370905 15:67038477-67038499 TGAAAAAAGCTTGGGAAGTCAGG - Intergenic
1128654090 15:69446570-69446592 TGGAAAGAACATGGGAAGGTAGG + Intronic
1128719731 15:69939637-69939659 TGGAAGAAGCCAGGGAAGGAAGG + Intergenic
1129484261 15:75853962-75853984 TGGAAAGAGCAGGAGAAGGATGG + Intronic
1129983866 15:79898569-79898591 TGCAGAAAGCATGGGAAGGAAGG + Intronic
1129990793 15:79960623-79960645 TGCAGAAAGCATAGGAAAGAAGG + Intergenic
1130768224 15:86895091-86895113 GGAAAAAAGAAAGGGAAGGAGGG - Intronic
1131714086 15:95089717-95089739 TAGAAAAAGAAGGGGGAGGAGGG + Intergenic
1132149897 15:99451918-99451940 TGGAGGGAGCATGTGAAGGATGG - Intergenic
1132421176 15:101671134-101671156 TTGAAAAAGCAGGGGAAAAAAGG - Intronic
1133175094 16:4008457-4008479 TGGCAAATGTATCGGAAGGAGGG + Intronic
1133388462 16:5389621-5389643 TGGAAAGAGAGAGGGAAGGAGGG - Intergenic
1133404411 16:5511535-5511557 GGGAGAAAGAAGGGGAAGGAGGG - Intergenic
1133431621 16:5742178-5742200 TGGAGGAAGGAAGGGAAGGACGG - Intergenic
1134449234 16:14353774-14353796 GGGAAAAGGCATGGCAGGGAAGG + Intergenic
1134914163 16:18055541-18055563 CTGAAAAAGAAAGGGAAGGAAGG + Intergenic
1135828898 16:25755443-25755465 TGGAAAAACCATGGCATGCATGG + Intronic
1135833015 16:25795331-25795353 TGGAAGATGCATGGGTAGAAAGG - Intronic
1135833658 16:25802527-25802549 TTGAAAAAGAATGACAAGGAAGG - Intronic
1135923743 16:26674005-26674027 AGGAAACACCATGGGAAGTAGGG - Intergenic
1135932167 16:26747556-26747578 TAGAAAGAGCAGGGGAGGGAGGG - Intergenic
1136495131 16:30638428-30638450 AGGGAAAAGCATGGAAAGGAAGG - Intergenic
1136537854 16:30910730-30910752 TGGAAAAAGGACAGGAGGGATGG + Intergenic
1137381669 16:48004978-48005000 TGGAAAAGCAATGGGGAGGAGGG + Intergenic
1137940253 16:52676982-52677004 TAGAAAAAGTCTGTGAAGGAAGG - Intergenic
1138339425 16:56279041-56279063 TGAAAAAAACATGAGAGGGAAGG - Intronic
1140257555 16:73349902-73349924 AGGAAAAAGGAGGGGAAGGGAGG - Intergenic
1140638423 16:76943776-76943798 GGGAAGAAGAAAGGGAAGGAAGG - Intergenic
1141239362 16:82250704-82250726 TGGAGAAAGCATGAGCAGAAAGG - Intergenic
1142255295 16:89011069-89011091 TGGATAAAGCGTGGGTAGGTGGG - Intergenic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1142682854 17:1560665-1560687 AGGAAAAAGAATCAGAAGGATGG + Intronic
1143325323 17:6094761-6094783 TGGCAGAAGCAAGAGAAGGAAGG + Intronic
1146944194 17:36862944-36862966 TATAAAAAGCTTGGGAGGGAGGG + Intergenic
1147195980 17:38766934-38766956 TGGAAGAAGAGGGGGAAGGATGG + Exonic
1147754177 17:42757346-42757368 GGGAAAAAGGAAGGAAAGGAGGG - Intergenic
1147845905 17:43403741-43403763 TGGAAAGGGCATGGGAAAGTGGG - Intergenic
1148253530 17:46107467-46107489 TGGAGAAAGTATTTGAAGGAGGG - Intronic
1148790388 17:50169312-50169334 AGGAAGCAGCATGGGAGGGAAGG - Intronic
1149288731 17:55195019-55195041 TGGACCAAGCAAGGGAGGGATGG + Intergenic
1149752484 17:59159187-59159209 TAGAAAAGGCATGGCCAGGAAGG - Intronic
1150509614 17:65736601-65736623 GGGAACAAGAATGGGAAAGAGGG + Intronic
1151055428 17:71025670-71025692 TGGAAAAAGGAAGGGAAGAAAGG + Intergenic
1151358818 17:73576260-73576282 GGGAAAGAGCATGCCAAGGATGG + Intronic
1151416894 17:73972496-73972518 AGGAAAGAGGAGGGGAAGGAAGG + Intergenic
1151565692 17:74896589-74896611 TGGGAAAGGCAAGGGAAGGCAGG + Intergenic
1151654649 17:75490250-75490272 TGGAAAGAGCAGGGGGAGGATGG - Exonic
1152145990 17:78569204-78569226 TGGAAAAGGCAAGAGAAGAAGGG + Exonic
1153800137 18:8661400-8661422 GGGAAGAAGGAAGGGAAGGAAGG + Intergenic
1154414871 18:14171319-14171341 GGGAAAAAGCATGGCCAGGGAGG + Intergenic
1155396288 18:25390096-25390118 TAGAAAAAGAATGGAAAGGTGGG + Intergenic
1155483621 18:26316809-26316831 TGGAAGAAGCAAAGGAATGAAGG - Intronic
1155558387 18:27047721-27047743 TGGTAGAAACTTGGGAAGGATGG + Intronic
1156146960 18:34194398-34194420 AGGAAAAAGGTAGGGAAGGAGGG + Intronic
1156420926 18:36952090-36952112 TGCAAGAAGCATGGCATGGATGG - Intronic
1156713920 18:39983018-39983040 TGGAAGAAGGAAGAGAAGGAGGG + Intergenic
1157461011 18:47894037-47894059 TGTAAAAAGAATGGGAAATAAGG + Intronic
1158186576 18:54778701-54778723 TGGAAGAAGAATGGAAAGGAAGG - Intronic
1158865629 18:61635572-61635594 TGGAAAGAGAAAGGGAAGAAGGG - Intergenic
1158905143 18:62004372-62004394 TGTAAGAAGCTAGGGAAGGAAGG - Intergenic
1158947123 18:62456791-62456813 TGGGAAAGTGATGGGAAGGATGG - Intergenic
1160273733 18:77411048-77411070 TGGAAAACACATGTGAAGGCTGG - Intergenic
1160313347 18:77818599-77818621 AGGAAAATGGAAGGGAAGGAAGG - Intergenic
1160313352 18:77818619-77818641 AGGAAAAAGGAAGGGAAGGAAGG - Intergenic
1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG + Intergenic
1161458131 19:4380172-4380194 AGGAAGAAGCAAGGAAAGGAGGG - Intronic
1161672543 19:5622320-5622342 TGGAAAGAGGATAGGAAGGGAGG + Intronic
1161860245 19:6792507-6792529 TTGATCAAGCAAGGGAAGGAAGG + Intronic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1162769962 19:12943513-12943535 TGGAGGATGAATGGGAAGGATGG - Intronic
1162835799 19:13317050-13317072 TGGAAAAAGGGTGTGAGGGAGGG + Intronic
1163672793 19:18638305-18638327 TGGAACACGCATGGGATGGGTGG + Intronic
1163779766 19:19240107-19240129 GGGAAGAAGGATGGGGAGGAGGG - Intronic
1164441912 19:28285172-28285194 GGGAAAGAGGATGGGAGGGAAGG + Intergenic
1164858976 19:31547486-31547508 AGGAGGAAGCATAGGAAGGATGG + Intergenic
1165389391 19:35529619-35529641 TGAAAAGGGCATCGGAAGGAAGG + Intergenic
1166319049 19:42005320-42005342 TGTAAGATGGATGGGAAGGATGG - Intronic
1166824529 19:45600871-45600893 TGGAAGAAGCATTGGAGGGGAGG - Intronic
1167197646 19:48041729-48041751 GGGAAAAGGAATGGGAGGGATGG - Intronic
1167601413 19:50457168-50457190 TCGAGAATGCATGGAAAGGAGGG + Intronic
1202690999 1_KI270712v1_random:95881-95903 TGGAAAAAACATGGCCAGGGAGG + Intergenic
925095357 2:1194225-1194247 GGGAAGAAGCATGGTCAGGATGG + Intronic
925363385 2:3295073-3295095 TGGAAAGAGGATGGGCTGGATGG - Intronic
925869476 2:8256584-8256606 TGGAAAAAGGAAGAGAAAGAGGG - Intergenic
925886763 2:8400421-8400443 TGGAGAAGGCAGGGGAAGAAAGG - Intergenic
926116381 2:10216145-10216167 AGGAAAAGGAAAGGGAAGGAAGG + Intergenic
926272663 2:11378436-11378458 TGGAAAAAGCCCAGGGAGGAAGG - Intergenic
927132650 2:20073501-20073523 TTGAAAAATGATGGGAGGGATGG - Intergenic
927158558 2:20236496-20236518 GGGAAGAAGGGTGGGAAGGAAGG - Intergenic
927654068 2:24930529-24930551 TGGAAAAAGGATGGCAAAGCAGG - Intergenic
927661892 2:25000557-25000579 GAGAAAAAGCAAGGGAAGAAAGG - Intergenic
927821412 2:26268848-26268870 TAGAAAAAGCAGGGGAAGGCTGG + Intronic
928392186 2:30918594-30918616 TTGACAAAGCACAGGAAGGAAGG + Intronic
928452191 2:31386909-31386931 TGGACAAGGCATGAGAAGGGAGG + Intronic
928973902 2:37063331-37063353 TGAAAAAGGCCAGGGAAGGAAGG + Intronic
929324940 2:40598437-40598459 TGGAAAATGCATGAGAGGGGCGG + Intronic
929635888 2:43520919-43520941 AGAAAAAAGAAAGGGAAGGAGGG + Intronic
930528606 2:52563037-52563059 TGGAAAATGCATCTAAAGGAGGG + Intergenic
930731909 2:54735976-54735998 TGGAAAAAGAATGGGGAAGGAGG + Intronic
930816921 2:55607875-55607897 TGGAAAAGGCATTGGATGGCTGG - Intronic
931127805 2:59297139-59297161 TGGAAAAAGCTGGGGAATGATGG + Intergenic
931528019 2:63179501-63179523 TGGGAAGAGCAAGGGAAGGCTGG - Intronic
931610443 2:64093438-64093460 TGAAAAAAGGGTGGGAAGGAGGG + Exonic
931822925 2:65970711-65970733 GGGAAACAACATGGGAAGGTAGG + Intergenic
932061692 2:68507018-68507040 TGGAGAAGGAATGGGAGGGAAGG + Intronic
932194257 2:69769554-69769576 TCTAAAAGGCAGGGGAAGGAGGG - Intronic
932286294 2:70534924-70534946 TGGAAGCAGCATGGCTAGGATGG + Intronic
932338187 2:70943048-70943070 GTGAAAAGGCAAGGGAAGGAGGG - Intronic
932470099 2:71949428-71949450 TGGAAAAGGCATGGCAAGGATGG + Intergenic
932685263 2:73863760-73863782 TAGACAAAGAATGGGAAGAAGGG - Exonic
932964361 2:76454252-76454274 AGGAAGAATCACGGGAAGGAGGG + Intergenic
933955395 2:87358070-87358092 TGGAAAAAACATGGCCAGGGAGG - Intergenic
934462020 2:94217621-94217643 TGGAAAAAACATGGCCAGGGAGG - Intergenic
934865708 2:97808515-97808537 TGAAACAAGTATGGGGAGGAGGG - Intronic
935209618 2:100927643-100927665 TAGCAATAGCATGGGAAGAATGG - Intronic
935815255 2:106841574-106841596 TGGAATTAGCCTGGGAAGAAGGG + Intronic
935926420 2:108074537-108074559 TGGAAAATGGATAGGCAGGAAGG - Intergenic
935955056 2:108367633-108367655 TGTAAAAAGCATGCCAAGGCTGG + Intergenic
936703722 2:115044529-115044551 TGAGAAAAGCACTGGAAGGATGG + Intronic
937540720 2:122949301-122949323 TGCAAAAAGCCTGGGACTGATGG + Intergenic
937619600 2:123970638-123970660 AGGAAGAAGGAAGGGAAGGAAGG + Intergenic
937840228 2:126518054-126518076 CAGAACAAGCATGAGAAGGAAGG + Intergenic
938478965 2:131643478-131643500 GGGAAAAAGGAGAGGAAGGAAGG - Intergenic
938671185 2:133588377-133588399 GGGAAGAAGGAAGGGAAGGAGGG - Intergenic
938798112 2:134735585-134735607 TGGAAAAAGCAAGGTAGGGCAGG + Intergenic
939069854 2:137526082-137526104 TAGTAAAACCAGGGGAAGGAGGG - Intronic
939079590 2:137643782-137643804 AGGACAAAGGATGGGAGGGAGGG + Intronic
939115655 2:138057366-138057388 AGGAAAAAGAAAGAGAAGGAAGG - Intergenic
940575127 2:155493770-155493792 GGGAAAGAGCGAGGGAAGGAGGG - Intergenic
940610852 2:155989808-155989830 GGGAGAAAGGATGGGGAGGAAGG - Intergenic
940670255 2:156659014-156659036 TGGACAAAGCATGGGTAAGCTGG + Intergenic
942252390 2:174058517-174058539 TGGAGAAAGCCAGGGAAGGGAGG + Intergenic
942946079 2:181675466-181675488 AGGAACAAGCTTGGGAAGGGGGG + Intronic
943194205 2:184721780-184721802 TGGAAAAGACATGGGAATAAAGG - Intronic
943757331 2:191570101-191570123 AGAAAAAAGAAAGGGAAGGAAGG - Intergenic
944289410 2:197988382-197988404 TGGACACAGAATGAGAAGGAAGG - Intronic
944785231 2:203063502-203063524 TGGAAAAAGGAAAGGAAAGAGGG + Intronic
945307066 2:208268727-208268749 AGGAAGAAGAAGGGGAAGGAAGG - Intronic
945619900 2:212122576-212122598 TGGAAAAAGTAAGATAAGGAGGG - Intronic
945855818 2:215068535-215068557 TGAACAAGGCAGGGGAAGGAGGG - Intronic
946098856 2:217301474-217301496 AGGGAAGAGCATGGGCAGGATGG + Intronic
946222712 2:218242253-218242275 TGGAATAAGCATTGAAATGATGG - Intronic
946415959 2:219539776-219539798 TTGGAAATGCATGGGAAAGAAGG + Exonic
947359487 2:229333086-229333108 TAGAAAAAGAAAAGGAAGGAAGG + Intergenic
947841340 2:233209664-233209686 TGGAAAAAGAATGGAAATGCAGG - Intergenic
947869731 2:233427979-233428001 GGGAGACAGCATGGGTAGGAAGG - Intronic
1168731870 20:91040-91062 TGGTAAAAACATGGTAAGGATGG - Intronic
1168778079 20:464754-464776 GGGAGAAAGCAAGAGAAGGAAGG - Intergenic
1168975861 20:1965462-1965484 TGGAGAAAACATGGGATGGGTGG + Intergenic
1169539754 20:6586646-6586668 TGTAAGAAGGAAGGGAAGGAAGG + Intergenic
1170366190 20:15600636-15600658 AGCAAAAAGCCTGGGGAGGAAGG + Intronic
1170911906 20:20580533-20580555 TGGAAATAGCAAGGCAAGGCAGG - Intronic
1171990110 20:31689484-31689506 TGGAAGAAACAAGGGAAGGTAGG + Intronic
1172216684 20:33240498-33240520 GGGAAAATGGATGGGAAGGAGGG + Intronic
1173563555 20:44023069-44023091 GGGAAAAAGGATGGGAAGGAGGG + Intronic
1173836064 20:46126724-46126746 TGGAGAAAGCCTAGGAAGGTGGG + Intronic
1173957034 20:47041261-47041283 AGGAAAGAGCATGGGGAGGGAGG - Intronic
1174707051 20:52667688-52667710 TGGAAGAAGGATGGGAAAGGGGG - Intergenic
1174741610 20:53019989-53020011 TGGAAGATGCAGGGGAAGCAAGG + Intronic
1175071092 20:56334548-56334570 AGGAGAAAATATGGGAAGGATGG - Intergenic
1175221231 20:57417612-57417634 TGGATAAAGGAAGGGATGGATGG + Intergenic
1175823901 20:61926230-61926252 AGGAGCAAGCACGGGAAGGAGGG + Intronic
1175984228 20:62755923-62755945 TGGAACAAGGGAGGGAAGGAGGG - Intronic
1176858153 21:13986952-13986974 GGGAAAAAGCATGGCCAGGGAGG - Intergenic
1177468973 21:21530492-21530514 TGGAAAATTATTGGGAAGGAAGG - Intronic
1177537077 21:22441910-22441932 GGGCAAAAGCATTGGAAGCAAGG + Intergenic
1178176679 21:30108376-30108398 TGGAGAAAGGATGGGAATGTAGG - Intergenic
1178299872 21:31443305-31443327 TTATAAAAGCATGGGAAGTAGGG + Intronic
1179644380 21:42766746-42766768 CTGAAAAACCAAGGGAAGGAGGG + Intronic
1180817956 22:18804557-18804579 TGGAAAAATGAGGGGAAGCAGGG - Intergenic
1181204172 22:21239012-21239034 TGGAAAAATGAGGGGAAGCAGGG - Intergenic
1181354219 22:22289132-22289154 TGGAAAAAACATGGCCAGGGAGG + Intergenic
1181534187 22:23533255-23533277 TGGAAAAAGGAAGGCAGGGAAGG + Intergenic
1182006005 22:26960244-26960266 TGGAAAAAGGGAGGCAAGGAAGG + Intergenic
1182142100 22:27968336-27968358 TGGCCAAACCATGGGCAGGAAGG + Intergenic
1182164187 22:28155896-28155918 TGGAAGAGACATGGGAAGAAGGG + Intronic
1182676133 22:32041479-32041501 TGGGAAAAGAAAGGAAAGGATGG - Intergenic
1182904335 22:33922174-33922196 TGGAAGGGGCAGGGGAAGGATGG + Intronic
1183473772 22:38024589-38024611 AGGGACAAACATGGGAAGGACGG + Intronic
1183784349 22:40021054-40021076 GGGAAAGAGCATGGGAAGTCAGG - Intronic
1183809948 22:40247105-40247127 TGCAAAAAGAATGGTAAGGTGGG - Intronic
1183949107 22:41342874-41342896 TAGAAAAAGGATGGGTAGGCCGG + Intronic
1184158057 22:42681855-42681877 AGGGAAAAGGAAGGGAAGGAAGG - Intergenic
1203222749 22_KI270731v1_random:56403-56425 TGGAAAAATGAGGGGAAGCAGGG + Intergenic
1203268080 22_KI270734v1_random:30410-30432 TGGAAAAATGAGGGGAAGCAGGG - Intergenic
1203297176 22_KI270736v1_random:51518-51540 GTGAAAAGGAATGGGAAGGAGGG + Intergenic
949614145 3:5735574-5735596 TGGGCAAGGCAGGGGAAGGAGGG + Intergenic
949932928 3:9093618-9093640 TGATAAAGGAATGGGAAGGAAGG - Intronic
950133783 3:10566078-10566100 TGGAGAAATCAGTGGAAGGAGGG - Intronic
950872781 3:16243664-16243686 TGGGAAAAGATTGGGAAGCATGG + Intergenic
951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG + Intergenic
951221807 3:20076514-20076536 TTCAAAAAGCACGGAAAGGAGGG - Intronic
951982829 3:28584440-28584462 AGGAGGAAGCATGGGATGGATGG - Intergenic
952721734 3:36540730-36540752 TAGAAAAAGCAAAGAAAGGAAGG + Intronic
952729249 3:36621429-36621451 TGACAACAGCAAGGGAAGGACGG - Intergenic
953410173 3:42686426-42686448 AAGAAAAAGAAGGGGAAGGATGG + Exonic
953643042 3:44727604-44727626 TGGAAAACGGATGGTAGGGATGG - Intergenic
954918384 3:54167956-54167978 TGGAAAAAAAATGACAAGGAAGG - Intronic
955240631 3:57174803-57174825 TGGCAAAGGCATGGGTAGGGTGG + Intergenic
955443107 3:58978172-58978194 TGGAAGAAGGCTAGGAAGGAAGG - Intronic
955502091 3:59595579-59595601 TGAGAACAGCATGGGAAAGACGG - Intergenic
956182057 3:66526718-66526740 TGGAAAGAGAATGGGCAAGAGGG + Intergenic
956964553 3:74443662-74443684 TGGAAAGAGTAGAGGAAGGAAGG - Intronic
957327824 3:78718870-78718892 GGGAAAAAGGGAGGGAAGGAGGG + Intronic
958065161 3:88535638-88535660 TGGAAAGAGTAAGGGAGGGAAGG - Intergenic
958575217 3:95940793-95940815 TGGAAAAAACATGAGAATGCAGG + Intergenic
959565122 3:107825967-107825989 TGGAGAAAGCTTGGGTGGGAGGG - Intergenic
960271569 3:115680058-115680080 AGGAGACAGAATGGGAAGGAAGG - Intronic
960314768 3:116163002-116163024 TAGAAAGAGCTTGGGAAAGAGGG + Intronic
960424123 3:117485393-117485415 GGGAAAAAGGAAGGGAAGAAAGG + Intergenic
960797851 3:121507124-121507146 TGGAAAAGGCATGGAAGGGATGG + Intronic
960898490 3:122530652-122530674 TGAAAAAAGGAAAGGAAGGAAGG - Intronic
960993634 3:123327437-123327459 TGCAAAAAGGATGGTAAAGAGGG - Intronic
961362499 3:126376747-126376769 TGGGATATGAATGGGAAGGATGG - Intergenic
961799580 3:129436118-129436140 TGGAAAGAGGATGGGAAGAAGGG + Intronic
962068249 3:132006211-132006233 TGGAAAAAGCATGGCTATGCAGG + Intronic
962511143 3:136101833-136101855 TGGAAAAATAAAGGGAAGAAGGG + Intronic
962607149 3:137042057-137042079 TGGAAAAAGAGTGAGAAGGGAGG - Intergenic
962878732 3:139556052-139556074 TGGAGCACTCATGGGAAGGAGGG + Intergenic
962924883 3:139983283-139983305 AGAAAAAAAGATGGGAAGGATGG + Intronic
962987470 3:140548578-140548600 TGGAAAGGGGATGGGAAAGAGGG + Intronic
963440323 3:145333170-145333192 GGGAAGAATCATGGGAAAGAGGG + Intergenic
964119141 3:153163579-153163601 TGGAAAAAAAATGGGGGGGAAGG + Exonic
964180132 3:153873779-153873801 TGCAACAAACATGGGAAGGCAGG - Intergenic
964290677 3:155176949-155176971 TGGAAAGAGGATGGGCAGAATGG + Intronic
964339218 3:155690725-155690747 TGGAAAAAGGATGGGTGTGAGGG - Intronic
964409702 3:156384887-156384909 GTGAAAAAGCATGGGAAGGAGGG + Intronic
964683507 3:159368329-159368351 TGGAGAAAGCATGGGGAGCTAGG - Intronic
964829463 3:160867531-160867553 AGGAAAAAGGAGGGAAAGGAAGG - Intronic
965426538 3:168531272-168531294 TGGAAAAAGCCTGGGACAAAGGG - Intergenic
965957985 3:174394704-174394726 AGGAAAGAGAGTGGGAAGGAAGG + Intergenic
966666513 3:182477860-182477882 TAGAAAAAGACTGAGAAGGAGGG - Intergenic
966924297 3:184634464-184634486 TGGAGAAGGGATGGGCAGGAAGG - Intronic
967238124 3:187408180-187408202 TGGAAATGGCATGGTAAGGGTGG - Intergenic
967370471 3:188739261-188739283 TGGAAAAAGAAAAGGAAGGAAGG + Intronic
968266980 3:197369924-197369946 AAGAAAAAGGAAGGGAAGGATGG - Intergenic
968587138 4:1424551-1424573 TGGAACAAGCATGGAAGGGCAGG + Intergenic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969051744 4:4378235-4378257 TGAAAAAAGCAGGGGAAGGGCGG + Intronic
969452980 4:7285584-7285606 GGCAGAAAGCATGGGAAGGAGGG - Intronic
969606152 4:8203208-8203230 GGGAAAAGGCATGGCAGGGATGG + Intronic
969918967 4:10519126-10519148 TGAAAGAAGCCTGGGATGGATGG - Intronic
970187840 4:13481916-13481938 AGGAAAAAGAATGGGAATGTTGG + Intronic
970187921 4:13483082-13483104 TGACAGAAGCATGGGAAAGAAGG + Intronic
970434711 4:16022196-16022218 TGGAAAAAGCCAGGACAGGAAGG + Intronic
971428295 4:26537487-26537509 TAGAATAAGCATGGGAATGGGGG - Intergenic
971663384 4:29449964-29449986 AGGAAAGAGGAGGGGAAGGAAGG + Intergenic
971877889 4:32327936-32327958 AGGAAAAAGCATCACAAGGATGG + Intergenic
972103169 4:35447565-35447587 GGGAAAAAGGAAGGGAGGGAGGG + Intergenic
973031862 4:45353671-45353693 TGAATAAAGCATCAGAAGGATGG + Intergenic
973336232 4:48959301-48959323 TGGGAAAAGGAGGGGAGGGAGGG + Intergenic
974091952 4:57320934-57320956 AGGAGAAAGCAGAGGAAGGAAGG - Intergenic
974513878 4:62882469-62882491 AGGAAAAAGCATAGTAAAGAAGG - Intergenic
975184585 4:71386516-71386538 TCCAAAGAGCATGGGAAGAAGGG - Intronic
976238735 4:82930592-82930614 TGGAAAAGGCAAGAGAAGGTAGG + Intronic
976293640 4:83447911-83447933 TTGAAAAAGCAAGGTAAGGCCGG + Intronic
976571724 4:86619543-86619565 TGGAAAAGGCAGTGGAGGGAGGG + Intronic
976632627 4:87254393-87254415 TGGAAGAAGCAAGAGAAGGTTGG - Intergenic
976846943 4:89499849-89499871 TGAAAACAGCATGGGCAAGAGGG + Intergenic
977040298 4:92008139-92008161 TTGAAAAAGTCTGGGAAGGGAGG + Intergenic
977830804 4:101590369-101590391 TGTGAAAAGCATGTGAATGATGG + Intronic
977886050 4:102252708-102252730 AGGAAATAGCATGGGGATGAAGG - Intronic
978281967 4:107028079-107028101 TGGAAAGAGCATGGAAACAATGG - Intronic
979502174 4:121453237-121453259 AGGAAAAAGAAAGGGAAGAAGGG + Intergenic
979909543 4:126344543-126344565 AGGAAAAAGAGAGGGAAGGAGGG + Intergenic
979979533 4:127237550-127237572 TGGAAAAAGAAAGAAAAGGAGGG + Intergenic
981333954 4:143546299-143546321 TGGAAAATTCATAGGAAAGACGG - Intronic
981597283 4:146440777-146440799 AAGAAAAAGCAAGGAAAGGAAGG + Intronic
982271633 4:153595621-153595643 TAGAAAAAGCAGTGGAAAGAGGG + Intronic
982538810 4:156641353-156641375 GGAAAAAAAGATGGGAAGGAAGG + Intronic
982626143 4:157768651-157768673 TGGGATAAGCATAGGAAAGAAGG + Intergenic
983527365 4:168772837-168772859 AGAAAAAAGAAAGGGAAGGAAGG + Intronic
983786471 4:171736885-171736907 TGGAAAATGCATTGTAAGGAGGG + Intergenic
984716826 4:182933759-182933781 TGGAGAAAAAATGTGAAGGAAGG - Intergenic
984742754 4:183182936-183182958 TGGAAGAAGAGTAGGAAGGAAGG - Intronic
984851972 4:184162279-184162301 TGGAAAAAAGGGGGGAAGGAAGG + Intronic
984973872 4:185212949-185212971 AAGAAAAAACAAGGGAAGGAAGG - Intronic
985176907 4:187211930-187211952 TAGAGAGAGCATGGGAAGAAAGG - Intergenic
985920617 5:2969562-2969584 TGTAAAAAGCCTGGGTAGGAGGG + Intergenic
986468361 5:8049943-8049965 AGGAAAAGGGAAGGGAAGGAAGG + Intergenic
986530126 5:8727071-8727093 AAGAAAGAGCAAGGGAAGGAAGG + Intergenic
986553285 5:8982632-8982654 TGCAAACAAAATGGGAAGGAGGG - Intergenic
986793194 5:11183328-11183350 TGAAAAAGGCATGGAAAGTAAGG + Intronic
987262342 5:16216057-16216079 TGGATAAAGCCCAGGAAGGAGGG - Intergenic
987701976 5:21412250-21412272 TGGAAAAAGAATGGGTAAAAAGG - Intergenic
987909514 5:24123396-24123418 TGGAAGATGAATGGGAAGAAAGG + Intronic
988737557 5:34037956-34037978 TGGAGAAGGGAGGGGAAGGAGGG + Intronic
989631678 5:43489903-43489925 TGGAAAAATGATAGGAAGAAAGG - Intronic
990090888 5:52047035-52047057 TGAAACCAGCCTGGGAAGGATGG + Intronic
990749501 5:58998862-58998884 TGGAAAAAGCCTGCCAAGCATGG + Intronic
991051457 5:62277060-62277082 TTGAAAAAGCATACGAATGAAGG - Intergenic
991355787 5:65767455-65767477 TGCAGAGAGCAGGGGAAGGAGGG + Intronic
991516797 5:67445180-67445202 AGGATACAGCAGGGGAAGGATGG - Intergenic
991574011 5:68083938-68083960 GGGAGAAAGGGTGGGAAGGAGGG + Intergenic
991578800 5:68132902-68132924 TGAAAAAGACATTGGAAGGAAGG - Intergenic
991964160 5:72074382-72074404 CTGAATAAGCAAGGGAAGGAAGG - Intergenic
992645584 5:78808235-78808257 TGGAAATAATATGGGGAGGAGGG - Intronic
992648543 5:78834966-78834988 TGGAAAAAGGAAGGAAGGGAGGG - Intronic
992748542 5:79841648-79841670 TGAAACAAGGAAGGGAAGGAGGG + Intergenic
992924185 5:81564286-81564308 TGGAGAAAGGGAGGGAAGGAAGG + Intronic
993095526 5:83474223-83474245 GGAAAAAAGAAAGGGAAGGAAGG + Intronic
993187502 5:84637942-84637964 GGGAAAAAGGAAGGGAGGGAGGG - Intergenic
993400930 5:87450282-87450304 TGTAAAAGGCAAGGGAAGGTTGG + Intergenic
993959476 5:94279551-94279573 TAGAAAAAGAATGGGAAGAAAGG - Intronic
994287780 5:97991294-97991316 TTTAAAAAGCTTGAGAAGGAGGG + Intergenic
995673225 5:114631903-114631925 TGTAAAAAGAAGGGGAGGGAAGG - Intergenic
995778259 5:115748328-115748350 GGAAAAAAGGATGGGAGGGAGGG + Intergenic
996138412 5:119873974-119873996 GGGAAGAATCATGGGAAAGAAGG + Intergenic
997178886 5:131807652-131807674 AGGAAAATGCAAAGGAAGGATGG - Intronic
997415845 5:133727932-133727954 TGGAAAAAGGATGGAAAGAGAGG + Intergenic
997672464 5:135686734-135686756 TGGAAAAAGGGAAGGAAGGATGG + Intergenic
997763335 5:136472428-136472450 GGGAAGAAGGAAGGGAAGGAAGG - Intergenic
997950801 5:138241364-138241386 AGGAAAAAGCATGGGAAGCTGGG + Intergenic
998132818 5:139659814-139659836 GGGAGAAAGCAAGGGCAGGAGGG - Intronic
999185623 5:149706235-149706257 TAGTAAAAGTATGGGAAGGAGGG - Intergenic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
999962792 5:156775347-156775369 TGTAGAAATCATGGAAAGGATGG - Intergenic
999964957 5:156799307-156799329 TGCAAACTGCATGGGAAGGGTGG + Intergenic
1001690160 5:173626909-173626931 TGAGAAAAGCAAGGGAAGGCAGG - Intergenic
1002221406 5:177685612-177685634 TGGCAAAGGAATGAGAAGGAAGG - Intergenic
1003538867 6:7000599-7000621 TGAAAAAAGGAAGGGAGGGAAGG + Intergenic
1003623878 6:7726197-7726219 CGCAGAAAGGATGGGAAGGAAGG - Intergenic
1004001481 6:11600812-11600834 AGGAAGAAGAATGGGAAGAAGGG - Intergenic
1004387561 6:15185680-15185702 AGGAAAAAGAAAGGGAAGGAAGG + Intergenic
1004722616 6:18280879-18280901 TGGAGACAGCTTGGGAAAGATGG + Intergenic
1004747416 6:18524594-18524616 TGGAACAGGCATGGGATGGCAGG + Intergenic
1004751379 6:18565794-18565816 TGAAAAAAGGGAGGGAAGGAGGG - Intergenic
1004751425 6:18565973-18565995 AGGAAGAAGGAAGGGAAGGAGGG - Intergenic
1004770498 6:18775762-18775784 TAGAAAATGCATGGAAAGGGAGG + Intergenic
1006112719 6:31758388-31758410 TGGATAAAGAATGGGATGGTGGG + Intronic
1006302488 6:33200964-33200986 AGGAAAAGGCCTGGAAAGGATGG - Exonic
1006511466 6:34523785-34523807 TGGAAAAGGCAGAGGCAGGATGG + Intronic
1006736715 6:36278944-36278966 AAGATAAAGCAGGGGAAGGATGG + Intronic
1006868318 6:37227365-37227387 GGGAAAAAGAATGGGAAGGAAGG - Intronic
1007271424 6:40640439-40640461 GGGAGAAAGAATGAGAAGGAGGG - Intergenic
1008704197 6:54137902-54137924 TTGAAAGAGCTGGGGAAGGATGG - Exonic
1008947891 6:57119227-57119249 TAGAAAAAGCCAGGGAAGGCCGG + Intronic
1009396492 6:63205851-63205873 TGAGAATAGCATGGGAAAGACGG - Intergenic
1009659126 6:66587045-66587067 GGGAAGAAGGAAGGGAAGGAAGG - Intergenic
1010006055 6:70996901-70996923 TGGAAATAGCATGGGATTTAGGG - Intergenic
1010353329 6:74901954-74901976 TGGAGAAAATTTGGGAAGGAAGG - Intergenic
1011114315 6:83873925-83873947 AGGAAAAAGCATGCAAAGGATGG + Intronic
1011559576 6:88600959-88600981 TGGAGAAAGTATGGGGAGGAGGG - Intergenic
1011577058 6:88813815-88813837 TGGGAAAAGCTTGTGATGGAGGG - Intronic
1012986489 6:105881770-105881792 TGGCAAAAGCAGGGTTAGGATGG - Intergenic
1013177627 6:107690900-107690922 TGGAGAATGCATGGGAGGGGTGG + Intergenic
1013349685 6:109294067-109294089 GGGAAAAGGCATGGTAAGAAAGG - Intergenic
1013647057 6:112155435-112155457 TGGAAAAGGCAGGGGAACTAAGG - Intronic
1013655996 6:112247101-112247123 TGGAAAAATGAGGGAAAGGAAGG + Intronic
1014331378 6:120069486-120069508 TGCAACAAACATGGGAAAGAAGG + Intergenic
1015263753 6:131267986-131268008 AGATGAAAGCATGGGAAGGAAGG + Intronic
1015327372 6:131938194-131938216 TAGCAAAAGCAAGGGAAGCATGG + Intergenic
1015600804 6:134908726-134908748 TGAAAAAAACAAAGGAAGGAAGG + Intergenic
1015621071 6:135132259-135132281 TGGAAGCAGCAGGGGAAGCAAGG + Intergenic
1015732589 6:136363501-136363523 TGGAAAAAGGAAGGAAAGAAGGG - Intronic
1016060765 6:139627484-139627506 TGGAACAGGGCTGGGAAGGAGGG - Intergenic
1016280695 6:142414715-142414737 TGCAGAAAGCTTGGGAAAGAAGG + Intronic
1016298013 6:142596881-142596903 GGGAAACAGGATGGGAAGTAGGG - Intergenic
1016824321 6:148374282-148374304 AGGAATATGAATGGGAAGGAGGG + Intronic
1017082146 6:150680308-150680330 TGGAAAAAAGGTGGAAAGGATGG + Intronic
1017641539 6:156498862-156498884 TGGAAAAAGCCAGCCAAGGATGG + Intergenic
1019091846 6:169543046-169543068 TGTAAGAAGAATGAGAAGGAAGG + Intronic
1019782037 7:2946372-2946394 AGGAAAAATCATAGGAAGTAGGG + Intronic
1019957561 7:4427380-4427402 TGGAAAAACAATGGGAGGGAAGG - Intergenic
1020479443 7:8639719-8639741 TGAGAACAGCATGGGAAAGATGG - Intronic
1020770987 7:12394369-12394391 AGGAAAACGAATGGGATGGAGGG + Intronic
1021494873 7:21263400-21263422 AGGAATAAACATTGGAAGGAGGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022648525 7:32253998-32254020 GAGAAAATGCATGGGAATGAGGG + Intronic
1023043776 7:36194501-36194523 GGTAACAAGCCTGGGAAGGAAGG - Intronic
1023279899 7:38558568-38558590 AGGAATAATGATGGGAAGGAGGG + Intronic
1024859217 7:53818190-53818212 TGGAAAAAGTATGGGAGTGGTGG + Intergenic
1026222240 7:68410387-68410409 AGGAAGAAGGAAGGGAAGGAGGG + Intergenic
1026421567 7:70242410-70242432 AGGAAAGAGCAGGGGAAGTATGG - Intronic
1026579256 7:71600213-71600235 TTGAAATTTCATGGGAAGGAAGG + Intronic
1026595759 7:71733055-71733077 GGGAAGGAGCAAGGGAAGGAGGG + Intergenic
1026821094 7:73549519-73549541 AGGAAAAAGCGTGGGTACGATGG + Intronic
1027656825 7:80940734-80940756 TGGAAAAAGCAGAAGAAAGAAGG + Intergenic
1027856251 7:83515466-83515488 TCTAAGCAGCATGGGAAGGATGG - Intronic
1028328584 7:89559607-89559629 TGAAAAAAGAAAGAGAAGGAAGG + Intergenic
1028384315 7:90237200-90237222 AGGAAAAAGCAGTGGAAGTAGGG - Exonic
1028451798 7:90993511-90993533 TGAAAGAAGAAGGGGAAGGAAGG + Intronic
1029535514 7:101155105-101155127 CGGAAAGAGAATGGGAAGGGGGG - Intronic
1030638259 7:111974576-111974598 AGGAAAAGGGATGGGGAGGAGGG + Intronic
1031180758 7:118412111-118412133 AGGAAAAAGGAAGGGAGGGAGGG - Intergenic
1031519592 7:122747283-122747305 GGAAAAAAGGAGGGGAAGGAAGG + Intronic
1031606537 7:123774825-123774847 TAGGAAAAGCATGGCAAAGAAGG - Intergenic
1031629428 7:124029459-124029481 AGGAAAAAGCAGGGAAAAGAAGG - Intergenic
1031631230 7:124045563-124045585 TAGAAAAAATATGGCAAGGAAGG + Intergenic
1031906919 7:127470565-127470587 TGGGAAGGGCAAGGGAAGGAAGG + Intergenic
1032378507 7:131449695-131449717 GGGAAAAAGAATGGGAAGGAGGG - Intronic
1033147485 7:138883797-138883819 TGGAATATGCCTGGGCAGGAGGG - Intronic
1033584236 7:142762418-142762440 GGGAAAGAGGCTGGGAAGGAGGG + Intronic
1033740892 7:144274975-144274997 TGGAAGTGGCATGGGGAGGAGGG - Intergenic
1033753014 7:144374638-144374660 TGGAAGTGGCATGGGGAGGAGGG + Intronic
1033845607 7:145428139-145428161 TGGGAAAGGCATGGCAAGCAGGG + Intergenic
1033992955 7:147310752-147310774 TGTTAAAAGCATAGTAAGGAAGG + Intronic
1034207056 7:149326419-149326441 TGGTAAAAGCATGGGAAGTTCGG - Intergenic
1034829337 7:154295621-154295643 AGGAAAAAGGAAGTGAAGGAAGG - Intronic
1035541933 8:446902-446924 TGGAAGGAGAATTGGAAGGAAGG + Intronic
1035673643 8:1439270-1439292 TGGAAGAGGGAAGGGAAGGAGGG + Intergenic
1035818923 8:2570761-2570783 TGGAAAGAGGGAGGGAAGGAGGG + Intergenic
1035938023 8:3864407-3864429 GAGAAAAAGCATGAGAAGAAAGG + Intronic
1035945240 8:3954686-3954708 GGGAAGAATCATGGGAAAGAGGG - Intronic
1036541312 8:9714971-9714993 TAGAGAAAGCATGGAAAGAAGGG + Intronic
1036633745 8:10533150-10533172 TGGAAAATGTATGGGAATTAGGG + Intronic
1036764061 8:11535328-11535350 AGGAAAAGGGAAGGGAAGGAAGG + Intronic
1037005115 8:13768476-13768498 TGAAATAAGCATGAGAATGAAGG + Intergenic
1037406496 8:18547984-18548006 AGGAAAAAGAATGAAAAGGAAGG - Intronic
1037432849 8:18831909-18831931 TAGAAAAAGTATGGGAAGAAAGG + Intronic
1037716413 8:21404974-21404996 TGGGAAAAGCTGGGGAAGAAGGG + Intergenic
1038436712 8:27541521-27541543 TTGCAAAAGCTTGGGACGGAAGG + Exonic
1038559384 8:28558226-28558248 TGGCAATAGCATCGGAATGAAGG + Intronic
1038754035 8:30324247-30324269 AGGAAGAAGGAAGGGAAGGAAGG + Intergenic
1038852391 8:31292522-31292544 TGCAATAAGCATGGGAATGTAGG + Intergenic
1038852600 8:31294837-31294859 TGTAAAAAGCCGGGGAGGGAAGG - Intergenic
1038852868 8:31297159-31297181 TGTAAAAAGCCAGGGAGGGAGGG - Intergenic
1038969434 8:32616135-32616157 CGAAAAAAGCATGGAACGGATGG - Intronic
1041329819 8:56712802-56712824 TGGAAAAAGGAAGTAAAGGAAGG + Intergenic
1042580223 8:70269006-70269028 TAGAAAAAGCGTGGAAAGTAAGG + Intronic
1042788168 8:72572831-72572853 TTGAAAATGCATGGGACGGAGGG + Intronic
1042850332 8:73210317-73210339 GGAAAAAAACATTGGAAGGAAGG + Intergenic
1042938090 8:74080642-74080664 TGGAGAAAGGTTGGGAAGCAGGG - Intergenic
1042961385 8:74307148-74307170 AGGAAACAGGAAGGGAAGGAAGG - Intronic
1043266658 8:78274589-78274611 TGGAAGATGAATGGGAAGCAAGG - Intergenic
1045007971 8:97932563-97932585 TGGAAAGTGCGTGGGAAGGAAGG - Intronic
1045174013 8:99700717-99700739 TTCAAAAAGCATGGGAAGTGTGG + Intronic
1045359810 8:101422508-101422530 AGAAAAAAGAAAGGGAAGGAAGG + Intergenic
1045681607 8:104666795-104666817 GGGAATAATCATGGGAAAGAGGG - Intronic
1046037623 8:108862991-108863013 TGCAAGATGCGTGGGAAGGAAGG + Intergenic
1046200936 8:110926885-110926907 TAGAGAGAGAATGGGAAGGAAGG + Intergenic
1046342955 8:112882531-112882553 AGGGAAAAGAGTGGGAAGGAGGG - Intronic
1047013870 8:120701763-120701785 GGGAAGAAGCATTTGAAGGATGG + Intronic
1047736738 8:127772248-127772270 AGGAAAAAGAAAGGGAGGGAGGG + Intergenic
1047821419 8:128525402-128525424 AGGAAAAATCAAGGGAGGGAGGG - Intergenic
1047872148 8:129095920-129095942 TGGAAAGAGAAGGGGAAGCAAGG - Intergenic
1047872171 8:129096076-129096098 GGGAAAAAGCAGGGTAAAGAAGG + Intergenic
1048021457 8:130543249-130543271 TGGGAATAGAATGGAAAGGATGG - Intergenic
1048034660 8:130666088-130666110 TGGGAAAAGCAGGAGAAGGCAGG + Intergenic
1048174400 8:132138882-132138904 TGGCACAAAGATGGGAAGGATGG - Intronic
1048366433 8:133742691-133742713 TGAAAAGAGAAAGGGAAGGAGGG + Intergenic
1048945676 8:139444950-139444972 TGGAGATTGCATGGGAAGGGAGG + Intergenic
1049103850 8:140598888-140598910 AGGAAAACGCATGGGGAGGCTGG - Intronic
1049211720 8:141389731-141389753 TGGTAAGAGCGTGGGGAGGAAGG + Intergenic
1050041336 9:1496931-1496953 GGGAAAAGGTATGGGAGGGAAGG - Intergenic
1050131688 9:2419457-2419479 AGGAAAAAGGATGGGAAAGATGG + Intergenic
1050801960 9:9626538-9626560 TGGAAAAAGAAGAGGAAGGAAGG + Intronic
1050935924 9:11394214-11394236 TGGAAAAAGGGTGCAAAGGAAGG + Intergenic
1051014908 9:12462995-12463017 TGGAAGAAGGAAAGGAAGGATGG - Intergenic
1051014913 9:12463019-12463041 TGGAAGAAGGAGGGAAAGGAAGG - Intergenic
1051145539 9:14023463-14023485 AGGAAAAAGCATGGCAACTAAGG - Intergenic
1051573580 9:18587922-18587944 TGGAATAAACATGGGAATGCAGG + Intronic
1051858836 9:21601028-21601050 GGGAAACAGCATGCAAAGGAAGG + Intergenic
1052648299 9:31267664-31267686 GGGAAGAAGGAAGGGAAGGAAGG - Intergenic
1053580523 9:39399379-39399401 AGGAAAGAGGAAGGGAAGGAAGG - Intergenic
1053845019 9:42227457-42227479 AGGAAAGAGGAAGGGAAGGAAGG - Intergenic
1054102110 9:60958184-60958206 AGGAAAGAGGAAGGGAAGGAAGG - Intergenic
1054584249 9:66948679-66948701 AGGAAAGAGGAAGGGAAGGAAGG + Intergenic
1055332353 9:75197456-75197478 GGGAAAAAGAAAGGAAAGGAGGG - Intergenic
1055503394 9:76924210-76924232 TGGGAAAGGCAGGGGATGGATGG + Intergenic
1057026544 9:91738350-91738372 TGGAAAAAGAATGGGAGGACTGG + Intronic
1057077442 9:92146008-92146030 TGGAGCTAGCATGGGAGGGAGGG + Intergenic
1057108837 9:92447716-92447738 TGCAAGAAGCATGAGAAGGTAGG + Intronic
1057676167 9:97137650-97137672 AGGAAAAAGGGTGGGAAGGGTGG - Intergenic
1057721540 9:97535668-97535690 TGGAGAAAGCCAGGGAGGGAAGG + Intronic
1058456265 9:105140865-105140887 GGGAAATAGCCTGGGAAGGCAGG + Intergenic
1058663675 9:107289184-107289206 TTGAAAAAGGAAGGGAAGGAAGG - Intronic
1058883444 9:109305188-109305210 TGGAAGAAGCGCGGGAAGGTGGG + Intronic
1058953702 9:109926526-109926548 TGGGTACAGCATGGGGAGGATGG + Intronic
1058968495 9:110058719-110058741 TCTAAAGAGAATGGGAAGGAAGG - Intronic
1059379046 9:113909159-113909181 TGGAAAAGGAATGGGTTGGAGGG + Intronic
1059639524 9:116203102-116203124 AGAACAAATCATGGGAAGGATGG - Intronic
1059686893 9:116646425-116646447 TGGAAAAGTCATGGGAGGAAGGG + Intronic
1059952577 9:119481680-119481702 TGGAAAGAACATGGGAAGTGAGG + Intergenic
1060728368 9:126021268-126021290 AAGAAAAAGAAAGGGAAGGAAGG - Intergenic
1061246298 9:129402706-129402728 TGGAAAAAGGAAGGCAGGGAAGG - Intergenic
1185726555 X:2426506-2426528 AGGAAAAAGGGAGGGAAGGAAGG - Intronic
1185938380 X:4284850-4284872 TGGACAGAGTATGGGGAGGATGG + Intergenic
1186991981 X:15079921-15079943 TGGGAAAAGCAGGGTAAAGAAGG + Intergenic
1188047177 X:25439302-25439324 TGGAAAAAGGAGGGGAAAAAAGG - Intergenic
1188232659 X:27684262-27684284 GGGAAGCAGTATGGGAAGGAGGG + Intronic
1189054857 X:37687866-37687888 GGGAAAAAGAAAGGGAGGGAGGG + Intronic
1189650361 X:43182667-43182689 TAGAAAAAGCATGGTAAACAAGG - Intergenic
1189806256 X:44738290-44738312 AGCAAAAAGCTTGGGAAGGCTGG + Intergenic
1189853707 X:45201357-45201379 TGGTAAAAGTGGGGGAAGGAGGG - Intergenic
1190188420 X:48255880-48255902 AAAAAAAAGCATGGGCAGGATGG - Intronic
1190432029 X:50387443-50387465 TGGTAAAAGAAAGGAAAGGAGGG - Intronic
1190802795 X:53807439-53807461 TGGCAAAAGCACTGGAAAGAGGG + Intergenic
1191755251 X:64585966-64585988 GGGCAAAACAATGGGAAGGAGGG - Intergenic
1192554876 X:72081463-72081485 GGGAGAGAGAATGGGAAGGAGGG + Intergenic
1193074982 X:77346004-77346026 GGTAAAAAGGATGGGGAGGACGG - Intergenic
1195092877 X:101479884-101479906 TGGAAAAAGCAGGGCAATGAAGG + Intronic
1195479296 X:105324335-105324357 CAGAAAAAGCAGGGGAAGGCTGG - Intronic
1195813589 X:108860503-108860525 TTGAAAATGCAGGGAAAGGAAGG - Intergenic
1197140251 X:123109992-123110014 TGGAAAAATCAAAAGAAGGAAGG - Intergenic
1197240298 X:124116134-124116156 TGGAAATAGGATGGAAAGAATGG - Intronic
1197547202 X:127839460-127839482 TGAGAACAGCATGGGAAAGATGG + Intergenic
1198015409 X:132605339-132605361 GGGAAAAGGCATGAGAAGGGAGG + Intergenic
1198171049 X:134105551-134105573 GGGAAAAAGCAAGAGAAAGATGG + Intergenic
1198483725 X:137065577-137065599 TGGAAAAAGCACAGCAGGGAAGG - Intergenic
1198727827 X:139695527-139695549 TGGAAAAAACATGGAGTGGATGG + Intronic
1198732601 X:139748493-139748515 TGGAAAAAGCACTGGCAAGAGGG + Intronic
1198884791 X:141322667-141322689 AGAAAGAAGCAAGGGAAGGAAGG + Intergenic
1199215892 X:145259971-145259993 TGTGAAATGCATAGGAAGGAGGG - Intergenic
1199456780 X:148037950-148037972 TCCAGAAAGCATGAGAAGGATGG + Intergenic
1199488061 X:148369913-148369935 TAGAAAAAGCATGGCCAGTAAGG + Intergenic
1201328959 Y:12797984-12798006 AGGAGAAAGGAAGGGAAGGAGGG - Intronic
1201766104 Y:17574917-17574939 TGGGGAAAGGAGGGGAAGGATGG + Intergenic
1201835448 Y:18331072-18331094 TGGGGAAAGGAGGGGAAGGATGG - Intergenic
1201943520 Y:19484424-19484446 TTGGAAAATCAAGGGAAGGATGG + Intergenic
1202076021 Y:21038703-21038725 TGCAAAAAGTAGGGTAAGGATGG + Intergenic