ID: 1082783559

View in Genome Browser
Species Human (GRCh38)
Location 11:57304205-57304227
Sequence CTTTAATCCCAGTGGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 147}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082783559_1082783565 -8 Left 1082783559 11:57304205-57304227 CCAGGTTCCCACTGGGATTAAAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1082783565 11:57304220-57304242 GATTAAAGCAGGAGGAGAGTGGG 0: 1
1: 0
2: 0
3: 32
4: 296
1082783559_1082783571 24 Left 1082783559 11:57304205-57304227 CCAGGTTCCCACTGGGATTAAAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1082783571 11:57304252-57304274 TCAATACCAAGCAGGAAGAGGGG 0: 1
1: 0
2: 3
3: 14
4: 204
1082783559_1082783575 30 Left 1082783559 11:57304205-57304227 CCAGGTTCCCACTGGGATTAAAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1082783575 11:57304258-57304280 CCAAGCAGGAAGAGGGGGCAGGG 0: 1
1: 0
2: 3
3: 70
4: 575
1082783559_1082783567 -3 Left 1082783559 11:57304205-57304227 CCAGGTTCCCACTGGGATTAAAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1082783567 11:57304225-57304247 AAGCAGGAGGAGAGTGGGGCAGG 0: 1
1: 1
2: 7
3: 118
4: 989
1082783559_1082783568 16 Left 1082783559 11:57304205-57304227 CCAGGTTCCCACTGGGATTAAAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1082783568 11:57304244-57304266 CAGGTGAGTCAATACCAAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1082783559_1082783564 -9 Left 1082783559 11:57304205-57304227 CCAGGTTCCCACTGGGATTAAAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1082783564 11:57304219-57304241 GGATTAAAGCAGGAGGAGAGTGG 0: 1
1: 0
2: 9
3: 53
4: 461
1082783559_1082783573 29 Left 1082783559 11:57304205-57304227 CCAGGTTCCCACTGGGATTAAAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1082783573 11:57304257-57304279 ACCAAGCAGGAAGAGGGGGCAGG 0: 1
1: 0
2: 1
3: 56
4: 503
1082783559_1082783566 -7 Left 1082783559 11:57304205-57304227 CCAGGTTCCCACTGGGATTAAAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1082783566 11:57304221-57304243 ATTAAAGCAGGAGGAGAGTGGGG 0: 1
1: 0
2: 2
3: 30
4: 412
1082783559_1082783570 23 Left 1082783559 11:57304205-57304227 CCAGGTTCCCACTGGGATTAAAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1082783570 11:57304251-57304273 GTCAATACCAAGCAGGAAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 205
1082783559_1082783569 22 Left 1082783559 11:57304205-57304227 CCAGGTTCCCACTGGGATTAAAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1082783569 11:57304250-57304272 AGTCAATACCAAGCAGGAAGAGG 0: 1
1: 0
2: 1
3: 10
4: 202
1082783559_1082783572 25 Left 1082783559 11:57304205-57304227 CCAGGTTCCCACTGGGATTAAAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1082783572 11:57304253-57304275 CAATACCAAGCAGGAAGAGGGGG 0: 1
1: 0
2: 1
3: 26
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082783559 Original CRISPR CTTTAATCCCAGTGGGAACC TGG (reversed) Intronic
902242305 1:15097038-15097060 TTCTACTCCCAGTGGGAATCTGG + Intronic
904946854 1:34205743-34205765 CTTTATTCCCAGTGCTAAACAGG - Intronic
906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG + Intergenic
910336748 1:86141510-86141532 CTCTAATAACAGTGGCAACCAGG + Intronic
915996622 1:160570563-160570585 CTTTAAGAAGAGTGGGAACCTGG + Intronic
916533911 1:165685225-165685247 CTTTCATCCCAGTGAACACCTGG - Intronic
916744949 1:167678058-167678080 CTGTTATTCCAGTGGGAGCCTGG - Intronic
919179595 1:194063104-194063126 CTTCAATCCTAGTGAGAACATGG - Intergenic
920530842 1:206701162-206701184 CTGTATTCTCAGTGGGATCCAGG - Intronic
920705999 1:208251061-208251083 CTATAGTCCCAGGGAGAACCTGG - Intergenic
923860470 1:237887644-237887666 TTTTAATCCCACTGAGAAGCTGG + Intronic
1065315835 10:24463264-24463286 CTTTAATCACTGTTGGACCCAGG + Intronic
1065459091 10:25936853-25936875 CTTTAAGCACAGTAGGTACCTGG + Intronic
1067300846 10:45007799-45007821 CTTAAATCCCAGAGAGAACCTGG + Intergenic
1070693339 10:78543680-78543702 CTATAAGCCCAGGGGGAACCCGG + Intergenic
1075659094 10:124181034-124181056 CTCAAATCCCAGTGGCAACAAGG - Intergenic
1077037735 11:503406-503428 CTTTCCTCCCAGTTGGTACCAGG - Exonic
1082783559 11:57304205-57304227 CTTTAATCCCAGTGGGAACCTGG - Intronic
1082912031 11:58388348-58388370 CTTCACTCTGAGTGGGAACCTGG - Intergenic
1089577541 11:119456842-119456864 CTTTATTCCAAGTGGGAAAATGG + Intergenic
1091487050 12:899631-899653 CTTGAATTCAACTGGGAACCGGG + Intronic
1094824595 12:34260172-34260194 CATTAATCCCAATGGCAACTTGG - Intergenic
1096785151 12:54013070-54013092 CTTTCTTCCCATTGGGATCCTGG - Intronic
1097010779 12:55952223-55952245 CTTTAGTCCCATGGGGAACAAGG - Intronic
1097491239 12:60272333-60272355 CTTTACTCTCAGAGGGCACCTGG + Intergenic
1098077727 12:66750612-66750634 GTTTAATCCCAGAGGCAACAGGG + Intronic
1098624419 12:72644943-72644965 CTTTATTCCCAGGGAGAAGCAGG - Intronic
1098855158 12:75644396-75644418 TCTTGATCCCAGTGGTAACCTGG + Intergenic
1099203163 12:79699066-79699088 GTTTTAGCCCAGTGGGATCCAGG - Intergenic
1102961653 12:117097337-117097359 CTGTCATCCCAGTGGGAGGCTGG + Intronic
1108504757 13:51102715-51102737 CTTTAATAGCAGTGTGAACATGG - Intergenic
1110236397 13:73221874-73221896 CTATAATCCCCATGGGAGCCAGG + Intergenic
1112957173 13:105073995-105074017 CTATTATTCCTGTGGGAACCCGG + Intergenic
1113992794 14:16041727-16041749 CTTCCATCCAAGTGGGGACCCGG - Intergenic
1114621145 14:24096976-24096998 CTCGAATGCCAGTGGGAAGCTGG - Exonic
1118876265 14:69787399-69787421 CTTTTATTCCAGTGGGAAGATGG + Intronic
1120950130 14:90033284-90033306 CTTTGGTCTCAGTGGGATCCTGG + Intronic
1125205481 15:37149582-37149604 CTTCCATCCCAGTGGGAATCTGG - Intergenic
1126856647 15:52845824-52845846 CCTTACCACCAGTGGGAACCAGG - Intergenic
1127581052 15:60339777-60339799 CTTGAACCCCAGTGGAAGCCTGG - Intergenic
1129749175 15:78048648-78048670 CTCTAAATCCAGTGTGAACCCGG + Intronic
1131657768 15:94479350-94479372 CTTGAATCCAAGTGGGCTCCTGG - Exonic
1132328653 15:100994921-100994943 CTTTAATCCCACTGGATACCTGG - Intronic
1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG + Intergenic
1134083518 16:11340835-11340857 CTTTGATCTCACTGGGAAGCTGG + Intronic
1136912156 16:34153466-34153488 CTTCCATCCAAGTGGGGACCCGG - Intergenic
1138556697 16:57775117-57775139 CTTGCATCACAATGGGAACCTGG + Intronic
1138629302 16:58280747-58280769 CTTTTATCACAGGGGGACCCAGG - Exonic
1140042965 16:71421651-71421673 CAGTTATCCCGGTGGGAACCGGG + Intergenic
1146591509 17:34131734-34131756 CTTTAATCCCACTGAGACCCAGG + Intronic
1152108970 17:78346705-78346727 TTTTGCTCACAGTGGGAACCTGG + Intergenic
1152147361 17:78576525-78576547 CTGAAAGCCCTGTGGGAACCTGG - Intronic
1152533938 17:80939719-80939741 CTCTAATGCCAAAGGGAACCAGG - Intronic
1153277648 18:3383784-3383806 CTATAATCCCAGTGACAAGCAGG + Intergenic
1153792169 18:8588453-8588475 CTTTAACCACAGTGGGAAAGAGG - Intergenic
1155878196 18:31112317-31112339 CTTTTAGCCCAGTGAGACCCTGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158809081 18:61010230-61010252 CTTTAATCCCAGTGTCACTCTGG - Intergenic
1161092964 19:2371992-2372014 CTATAATCCCAGCTTGAACCCGG - Intergenic
1162115824 19:8428839-8428861 CTGTAATCCCAGCTTGAACCCGG + Intronic
1162288044 19:9755148-9755170 ATTTAATCCCCGTGGTCACCAGG - Intronic
1163977862 19:20869484-20869506 CATTCACCCCAGTGGGAACATGG + Intergenic
1163980762 19:20897668-20897690 CATTCATCACAGTGGGAACCTGG + Intergenic
1164554352 19:29239543-29239565 CTTTAAACCCAGTGGGTGCAGGG - Intergenic
1165848116 19:38831969-38831991 CCTTTGCCCCAGTGGGAACCTGG + Exonic
1166977982 19:46616183-46616205 CTATATTCCCAGTGGGCACGAGG + Intergenic
1168139166 19:54373670-54373692 CTGTAATCCCAGCTCGAACCAGG + Intergenic
1168280723 19:55304117-55304139 CTTAAATCCCACTGGGGACCTGG - Intronic
927243807 2:20941001-20941023 CTTTTCTCCCAGTGAGAACACGG - Intergenic
930751027 2:54934258-54934280 CTGACATCCCAGTAGGAACCTGG - Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
935251099 2:101261730-101261752 ATTTAATCCCATTAGGAACTAGG - Intronic
936980139 2:118256381-118256403 CTTTAAACCCAATGGGCACAGGG + Intergenic
938538905 2:132269182-132269204 CTTGCATCCAAGTGGGGACCCGG + Intergenic
939262020 2:139822529-139822551 ATTTAATCCCAGAGTGAACATGG + Intergenic
939488973 2:142854082-142854104 CTTTAAGCCCCGGGGCAACCAGG + Intergenic
942986104 2:182144213-182144235 CTTTCCTCCCAGTGGGTAACAGG + Intronic
943941139 2:193999457-193999479 GTTTAATCACAGGGGGAAACTGG - Intergenic
943960117 2:194253930-194253952 CCATAAAGCCAGTGGGAACCAGG + Intergenic
947305458 2:228741213-228741235 CTATACTCCAAGTAGGAACCAGG - Intergenic
1168894959 20:1318019-1318041 CATTAAGCCCAGCGTGAACCTGG - Intronic
1169853815 20:10081985-10082007 CTTTAATCACAGTAGGCAGCCGG + Intergenic
1171050199 20:21850997-21851019 CTTATATTCCAGTGGGAAACTGG + Intergenic
1171769060 20:29307600-29307622 CTTCCATCCAAGTGGGCACCCGG + Intergenic
1171812239 20:29754036-29754058 CTTCCATCCAAGTGGGGACCCGG + Intergenic
1171867815 20:30501093-30501115 CTTGCATCCAAGTGGGGACCCGG + Intergenic
1171907459 20:30911619-30911641 CTTCCATCCAAGTGGGGACCCGG - Intergenic
1173443799 20:43099876-43099898 CTATTAGCCCAGTGGGTACCTGG + Intronic
1177295916 21:19175485-19175507 CTGTAGTCCCGGTGTGAACCCGG + Intergenic
1178140112 21:29673078-29673100 CTTTATTCCCAGAGGGCAGCTGG + Exonic
1179894124 21:44351835-44351857 CTCTAATCCCAGAGGCAAGCAGG - Intronic
1180314476 22:11265792-11265814 CTTCCATCCAAGTGGGGACCCGG + Intergenic
1180340883 22:11617767-11617789 CTTCCATCCAAGTGGGGACCCGG - Intergenic
1181504281 22:23341101-23341123 CTTTGATGCCAGTGGGTACAGGG + Intergenic
1182340897 22:29620005-29620027 CTGTAATCCCAGTGGGAGGCCGG + Intronic
1183542972 22:38440583-38440605 GTATAATCCCAGTGGCACCCTGG + Intronic
1184224564 22:43121852-43121874 CTGTAATCCCAGCTTGAACCTGG - Intronic
1185291164 22:50028522-50028544 CCTGAATCGCAGTGGGAATCAGG + Intronic
950376900 3:12579778-12579800 CTTGAATCCCAGTGTGACCATGG + Intronic
959378477 3:105613488-105613510 CTTTGAGCCCAGTGGGTGCCAGG + Intergenic
965665559 3:171090017-171090039 ATTAAATTCCAGTGGGAATCTGG - Intronic
971570649 4:28206367-28206389 CTTTAGACCCATTGGAAACCAGG + Intergenic
975171261 4:71234369-71234391 ATTTAATCCTCATGGGAACCAGG + Intronic
977351259 4:95890739-95890761 CTATAATCCCAGTGGAGGCCAGG - Intergenic
977614833 4:99076542-99076564 CTTTACTCCTAGTTGGAGCCTGG - Exonic
978011602 4:103692030-103692052 CTTTAATTCCTCTAGGAACCTGG + Intronic
980092515 4:128457174-128457196 CTTGAATCCCAGGGGAAATCTGG - Intergenic
981315165 4:143334768-143334790 TCTAAACCCCAGTGGGAACCAGG + Intergenic
982879809 4:160699517-160699539 CTGTAATCCCAGCTTGAACCCGG + Intergenic
983275499 4:165612425-165612447 CTTTAATCCCTTTGTGAACTAGG + Intergenic
984081420 4:175253493-175253515 AATTAAGCACAGTGGGAACCAGG + Intergenic
985523131 5:388493-388515 CTTTTCTCCCAGGGGGAGCCTGG + Intronic
987383541 5:17308303-17308325 CTTTATTACCAGTGGGTACCTGG + Intergenic
990737518 5:58880195-58880217 ATTCAAACCCAGTGGGAGCCTGG + Intergenic
990773926 5:59284004-59284026 ATTTAATCCCAGAGGAACCCTGG - Intronic
991373982 5:65946624-65946646 CTTTTATCCCAGTGAAAACTGGG - Intronic
992550612 5:77856276-77856298 CTTTAATCACAGTTTGCACCAGG + Intronic
992698983 5:79320432-79320454 CTGTAATCCCAGATTGAACCCGG - Intronic
994267189 5:97731805-97731827 CTCAAATGCCAGTAGGAACCAGG - Intergenic
994593836 5:101806663-101806685 CTGAAATCTCAGTGGGCACCAGG - Intergenic
995407125 5:111810976-111810998 TTTTATTCCCAGTGAGCACCAGG - Intronic
997598153 5:135120887-135120909 CTTTGTTCCCAGTGGGAACTGGG + Intronic
997672505 5:135687124-135687146 CTTCACTCTGAGTGGGAACCAGG + Intergenic
1002822040 6:734899-734921 CATTAAGCCCTGTGGGTACCAGG + Intergenic
1003300332 6:4874935-4874957 CTTTGCTCTCAGTGGGTACCTGG + Intronic
1005657275 6:27953647-27953669 CTGTAATCCCAGCGGGAAGCTGG - Intergenic
1012628104 6:101429563-101429585 CTTTTCTCTCAGTGGCAACCTGG + Intronic
1013624082 6:111919993-111920015 CCTTAAACCCAGTGGGAAGGAGG - Intergenic
1015421224 6:133011511-133011533 CTTTCATTCAAGTGGGAACAGGG + Intergenic
1017696058 6:157017513-157017535 CTTAAATCCCTTTGGGAACAAGG - Intronic
1019187528 6:170229498-170229520 CTTCTAGCCGAGTGGGAACCAGG + Intergenic
1021927837 7:25550416-25550438 CTTTAATCCCAGAGGGGAGAAGG - Intergenic
1022218813 7:28291774-28291796 CTTTCACCCCAGTGGGGGCCAGG + Intergenic
1023018042 7:35985328-35985350 CATAACTCCCAGTGGGCACCAGG + Intergenic
1026805250 7:73425277-73425299 CTCAAAACCCAGTGGGAGCCAGG - Intergenic
1029622463 7:101698690-101698712 CTTTATTCCCAGGGGGCCCCAGG + Intergenic
1032075186 7:128832694-128832716 CCTTCCTCCCAGCGGGAACCAGG - Intronic
1033859064 7:145602497-145602519 AAGTAATCCCAGTGGGAAACTGG - Intergenic
1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG + Intergenic
1037188172 8:16090069-16090091 CTTTAATATCAGTGGGGGCCGGG + Intergenic
1037508001 8:19551668-19551690 CTTTCCTCCCAGTGGGCACTTGG + Intronic
1038054889 8:23848977-23848999 CTTTCAACCCTGTGGGAAGCAGG - Intronic
1040338104 8:46426436-46426458 CTTTCATCCCAGTAGCCACCAGG + Intergenic
1046070949 8:109252509-109252531 CTTTAATCCAATTCTGAACCAGG + Intronic
1048724820 8:137371565-137371587 CTATAATTCCAGGGGCAACCTGG - Intergenic
1055330983 9:75183716-75183738 TTCTAACCCCAGTGGGGACCCGG + Intergenic
1055824037 9:80302684-80302706 CTTTCATCCCAGTGGGGAAGGGG - Intergenic
1056549634 9:87641322-87641344 CTTTAATCCAAATGTCAACCAGG - Intronic
1059861500 9:118468205-118468227 CTTTAATCACAGTGTGACCTTGG + Intergenic
1203362787 Un_KI270442v1:231901-231923 CTTCCATCCAAGTGGGGACCCGG + Intergenic
1185592498 X:1286874-1286896 CCTTAATCCCTTGGGGAACCAGG - Intronic
1186030054 X:5358516-5358538 CTGTAATCCTAGTGAGACCCTGG + Intergenic
1186393005 X:9180133-9180155 CTTTAAGCCAAGTGGGAGCCTGG - Intergenic
1187290214 X:17946001-17946023 CTTTTATCTCGGTGGGATCCAGG - Intergenic
1187952390 X:24483964-24483986 CTGTAATCCCAGTGGTAGGCCGG - Intronic
1189337608 X:40179769-40179791 CTTTACTCCTAATGGGAAGCAGG - Intergenic
1191150226 X:57212813-57212835 CTTTAATATCAGTGTGATCCTGG + Intergenic
1193505971 X:82345486-82345508 CTTTAATCTCAGCAGGGACCAGG - Intergenic
1196496570 X:116330335-116330357 CTGTAATCCCAGCTTGAACCTGG + Intergenic
1199986423 X:152955345-152955367 CTTGAAACCCACTGGGAAACAGG + Intronic