ID: 1082785152

View in Genome Browser
Species Human (GRCh38)
Location 11:57312746-57312768
Sequence TGGACAGGCACTGCCTGTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 179}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082785152_1082785161 13 Left 1082785152 11:57312746-57312768 CCTCAACAGGCAGTGCCTGTCCA 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1082785161 11:57312782-57312804 CAGCAAAGAGAACACAGGGCTGG 0: 1
1: 0
2: 4
3: 47
4: 500
1082785152_1082785159 8 Left 1082785152 11:57312746-57312768 CCTCAACAGGCAGTGCCTGTCCA 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1082785159 11:57312777-57312799 GGCATCAGCAAAGAGAACACAGG 0: 1
1: 0
2: 1
3: 18
4: 278
1082785152_1082785164 20 Left 1082785152 11:57312746-57312768 CCTCAACAGGCAGTGCCTGTCCA 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1082785164 11:57312789-57312811 GAGAACACAGGGCTGGTCAGGGG 0: 1
1: 0
2: 1
3: 31
4: 399
1082785152_1082785162 18 Left 1082785152 11:57312746-57312768 CCTCAACAGGCAGTGCCTGTCCA 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1082785162 11:57312787-57312809 AAGAGAACACAGGGCTGGTCAGG 0: 1
1: 0
2: 1
3: 25
4: 288
1082785152_1082785163 19 Left 1082785152 11:57312746-57312768 CCTCAACAGGCAGTGCCTGTCCA 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1082785163 11:57312788-57312810 AGAGAACACAGGGCTGGTCAGGG 0: 1
1: 0
2: 0
3: 62
4: 547
1082785152_1082785165 27 Left 1082785152 11:57312746-57312768 CCTCAACAGGCAGTGCCTGTCCA 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1082785165 11:57312796-57312818 CAGGGCTGGTCAGGGGCTGCTGG 0: 1
1: 0
2: 11
3: 136
4: 1201
1082785152_1082785160 9 Left 1082785152 11:57312746-57312768 CCTCAACAGGCAGTGCCTGTCCA 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1082785160 11:57312778-57312800 GCATCAGCAAAGAGAACACAGGG 0: 1
1: 0
2: 2
3: 37
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082785152 Original CRISPR TGGACAGGCACTGCCTGTTG AGG (reversed) Exonic
900231633 1:1561835-1561857 GGGAAAGGCATTGCCTGTGGTGG - Intronic
900282204 1:1877759-1877781 TGGAAACAGACTGCCTGTTGGGG + Intronic
900543383 1:3215409-3215431 GGGACAGGCAAGGCCTATTGGGG + Intronic
901893061 1:12284685-12284707 TGGACTTGCACTTCCTGCTGGGG + Intronic
902378666 1:16042333-16042355 TGGACATGCAGTGCCGGCTGTGG + Intergenic
905004095 1:34696430-34696452 TGGTCATGAACTGCCTGTAGGGG - Intergenic
905796165 1:40817897-40817919 GGGACAGGGAGGGCCTGTTGAGG + Intronic
905887961 1:41501870-41501892 TGGACTGGCACTCCCAGCTGGGG + Intergenic
907138358 1:52160424-52160446 TAGAAAGGCACTGCCTTTGGAGG - Intronic
907267514 1:53271849-53271871 TGGACCAGCACTGCCTGCTGAGG + Intronic
908429312 1:64040618-64040640 TGGTCAGGTTCTCCCTGTTGAGG + Intronic
914858367 1:151368250-151368272 TGGCCAGGCAGTGGCTGGTGTGG + Exonic
914918279 1:151831376-151831398 TGGACAGGCCCTCCCAGGTGTGG - Intronic
918069336 1:181123304-181123326 TGGCAAGGGACTGGCTGTTGTGG + Intergenic
919824845 1:201496115-201496137 TTGACAGGCCCAGCCTGTGGGGG + Intronic
922762531 1:228141667-228141689 TGGAAAGGCACTCCCTGCTGTGG - Intronic
923771574 1:236942237-236942259 TGGACAGGCTCTGGCTTGTGGGG + Intergenic
924060719 1:240171109-240171131 TGGAAAGGCACTGCCTTTGGAGG + Intronic
1064398404 10:14999954-14999976 TGGACAGGCACAGCCCAGTGAGG + Intergenic
1066562012 10:36679711-36679733 TGGAAAGCCACTGCAGGTTGGGG + Intergenic
1067214692 10:44292837-44292859 CGGCCTGGGACTGCCTGTTGGGG - Exonic
1069550720 10:69362030-69362052 TGGTCTGGAACTGCCTGTTCAGG + Intronic
1072741370 10:97911978-97912000 TGGAGAGGCAGTGCTGGTTGTGG + Intronic
1074504553 10:114057085-114057107 TGGATGGGCACTGCCAGTAGTGG + Intergenic
1074678512 10:115880144-115880166 CTGACAGCCACTGCCAGTTGAGG - Intronic
1076460089 10:130636572-130636594 GGACCAGGGACTGCCTGTTGAGG + Intergenic
1082785152 11:57312746-57312768 TGGACAGGCACTGCCTGTTGAGG - Exonic
1083860731 11:65418632-65418654 TGGACTGGGACTGCCTGGGGTGG - Intergenic
1083970283 11:66070292-66070314 TCGACCGCCGCTGCCTGTTGCGG - Intergenic
1084729315 11:71063184-71063206 TGGAATGGCAGTGCCTGCTGAGG - Intronic
1085761775 11:79247525-79247547 TCCACAGCCACTGCCTATTGAGG + Intronic
1085933055 11:81108975-81108997 GGGGCAGCCACTGCCTGTTATGG - Intergenic
1086217582 11:84402497-84402519 TGGAAAGGCAGTGCCAGTAGTGG - Intronic
1087478786 11:98672565-98672587 TGGACAGCCACTGACTGATTAGG - Intergenic
1089646114 11:119880229-119880251 AGGACAGGCCCTGCCTCTGGAGG - Intergenic
1092258528 12:6940095-6940117 CGGGCAGGCAGTGCCTGCTGAGG - Intronic
1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG + Intronic
1095369146 12:41445469-41445491 TGGACAGTGATTGACTGTTGTGG - Intronic
1096799769 12:54102408-54102430 TGAACAGGGCCTGGCTGTTGAGG - Intergenic
1099543075 12:83939318-83939340 TGGCTATGCATTGCCTGTTGTGG + Intergenic
1101997220 12:109533939-109533961 TGGACGTGCACAGCCTGCTGGGG - Intronic
1102784118 12:115590236-115590258 TGGACAGGCACTACCAGAAGTGG - Intergenic
1103852762 12:123943923-123943945 TGGTCAGTCACAGTCTGTTGGGG - Intronic
1104648581 12:130514519-130514541 TGGAGAGGCAATGCCAGCTGTGG - Intronic
1106025444 13:25951462-25951484 AGGGCAGGAACTGCCTATTGAGG + Intronic
1107684306 13:42881312-42881334 AGGACAGGCATTGCCTGTAAAGG + Intergenic
1110306190 13:73989454-73989476 CACACAGGCACTGCCTTTTGTGG + Intronic
1113274428 13:108712739-108712761 TGCACTGGCACTGACTGTCGCGG - Intronic
1119444153 14:74649478-74649500 TGGTCAGGGGCTGCCTGTAGGGG - Intergenic
1120283104 14:82463912-82463934 TGGGCAGGAACTCCCTGTGGGGG + Intergenic
1120881764 14:89419205-89419227 TGGACCAGCCCTGCCTGATGTGG + Intronic
1122423250 14:101590492-101590514 TGGACAGGCGGGGCCTGTGGAGG - Intergenic
1122664584 14:103319738-103319760 AGGGCAGGCTCTGCATGTTGGGG + Intergenic
1202865087 14_GL000225v1_random:111826-111848 TGTCCAGGCTCTGCCTATTGGGG - Intergenic
1123497292 15:20841005-20841027 TGGTCAGGCACTGTCTATTCTGG - Intronic
1123554527 15:21414644-21414666 TGGTCAGGCACTGTCTATTCTGG - Intronic
1123590771 15:21851958-21851980 TGGTCAGGCACTGTCTATTCTGG - Intergenic
1124226866 15:27902615-27902637 TGGACAGTCACTGCCAGGAGAGG - Intronic
1124853112 15:33360254-33360276 TGGGCAGGGACTGACTGTGGAGG - Intronic
1130126322 15:81096989-81097011 GGGACAGACACTGGCTATTGTGG + Intronic
1132092769 15:98959340-98959362 TGGTCCGGCAGGGCCTGTTGTGG + Exonic
1202962872 15_KI270727v1_random:141837-141859 TGGTCAGGCACTGTCTATTCTGG - Intergenic
1132631620 16:920257-920279 TGGACATGCAGTGCGTGCTGTGG - Intronic
1132743920 16:1428927-1428949 TGGCCAGGCCCTGGCTGTGGGGG - Intergenic
1134404874 16:13947816-13947838 TGGAGATGCACTGGCTGTAGAGG - Exonic
1135920107 16:26642198-26642220 TGGACATGAACTTCCTGTTTTGG - Intergenic
1139517239 16:67459310-67459332 TGGACAGGGCCGGCCTGTGGAGG - Intronic
1139615181 16:68084637-68084659 GGGACAGGCCCTGCCCATTGGGG + Intergenic
1141557175 16:84843944-84843966 TGGGCAGGTACTCCCTGCTGGGG + Intronic
1141563159 16:84883675-84883697 TGGTCTGGAACTGCATGTTGAGG + Intronic
1143713257 17:8748470-8748492 AGGACAGGCAGTGTCTGGTGAGG - Intergenic
1144406272 17:14955484-14955506 TGGGCAGGGGCTGCCTGCTGAGG + Intergenic
1144624589 17:16838265-16838287 GGGGCAGGCACTGTCTCTTGGGG + Intergenic
1144771919 17:17764384-17764406 TGGGCAGGAAATGCCTGATGAGG - Intronic
1144881839 17:18434456-18434478 GGGGCAGGCACTGTCTCTTGGGG - Intergenic
1145150394 17:20509930-20509952 GGGGCAGGCACTGTCTCTTGGGG + Intergenic
1147722479 17:42547534-42547556 TGGAGGGGCACTGCCTGCCGGGG + Intergenic
1147795549 17:43039836-43039858 GGGCCAGGCTCTGCCTGTTGTGG - Intergenic
1148458354 17:47822978-47823000 TGGACAGGCACTGTCTGGCAGGG - Intergenic
1153942596 18:9990787-9990809 TGGACAGACAATGGCTGGTGGGG - Intergenic
1156337900 18:36186654-36186676 TGGCCAGGCCCTCCCTATTGAGG + Intergenic
1156601223 18:38609642-38609664 TGCTCAGGCATTTCCTGTTGTGG + Intergenic
1158028060 18:52927410-52927432 TAGAAATGCACTGCCTGTAGTGG - Intronic
1158544587 18:58385441-58385463 AGGAGAAGCACTCCCTGTTGCGG + Intronic
1159998603 18:74993425-74993447 TGGATGAGAACTGCCTGTTGCGG - Intronic
1161046415 19:2137168-2137190 TGGGCTGGCGCTGCCTGGTGTGG - Intronic
1162094756 19:8303792-8303814 GGGACACCCACTGCCTGCTGGGG - Intronic
1165769192 19:38368478-38368500 TGGGCAGTCACTGTCTGGTGTGG + Intronic
1168005954 19:53487481-53487503 TGGAGAGGCAGAGCCAGTTGCGG - Intronic
926363543 2:12112658-12112680 TTTACAGGCATTGCCTCTTGGGG - Intergenic
926394495 2:12427270-12427292 AGGACAGGCACTGCCTCCTGGGG + Intergenic
926415078 2:12641994-12642016 TGGACAGGCAATGCAGATTGTGG + Intergenic
926808785 2:16738028-16738050 TGGACTGGGAATGCTTGTTGGGG + Intergenic
927284577 2:21343428-21343450 TGGACAGGCTCTGGCAGGTGGGG + Intergenic
928339458 2:30429257-30429279 TGGACTGGCATTGCCTGTAGGGG - Intergenic
929805922 2:45145055-45145077 TGGGCAGGAACGGCCTGTTTGGG - Intergenic
929860926 2:45676735-45676757 TGGTCAGTCACTGCTGGTTGGGG + Intronic
931443495 2:62307732-62307754 TGGGTAGGCACTGCCTGATGAGG + Intergenic
933746869 2:85577979-85578001 TGCCCAGGCGCTGCCTGGTGTGG - Intronic
939222827 2:139325040-139325062 TGTACAGGCTCTTTCTGTTGTGG + Intergenic
947791635 2:232872255-232872277 GGCACAGGCCCTCCCTGTTGGGG + Intronic
948836392 2:240628120-240628142 TGGGCAGGCACTGTGCGTTGGGG - Intronic
1170566847 20:17612409-17612431 GGGTGAGGCACGGCCTGTTGTGG - Intergenic
1171302071 20:24071872-24071894 AAGACAGGCACTGCAAGTTGGGG + Intergenic
1172764239 20:37342681-37342703 AGGACAGGGACTGCTTGTGGAGG + Intergenic
1172996848 20:39077151-39077173 TGGACAGGCAGACCCTGATGAGG - Intergenic
1175892745 20:62322696-62322718 TGCACAGGCAGTGCCCGCTGTGG + Exonic
1178799403 21:35778472-35778494 TGGCCAGGCCCTGCCTCTGGAGG - Intronic
1178943632 21:36928135-36928157 TGGATATGCACTGCCTGAGGTGG - Intronic
1179496183 21:41772620-41772642 TGGAGAGCCTCTGCCTGGTGGGG - Intergenic
1180065616 21:45410756-45410778 AGGAGAGGCACTGTCTGTTTTGG + Intronic
1180150763 21:45946091-45946113 GGGACAGGCCCAGCCTGCTGGGG - Intergenic
1182395483 22:30032994-30033016 TGGAGAGAAACTGCTTGTTGGGG + Intergenic
1183739315 22:39661332-39661354 TGGACGGGCGCTTCCTGCTGGGG + Intronic
1183831861 22:40422485-40422507 AGGACAGGCACTAACTGATGAGG + Intronic
1184197302 22:42938559-42938581 TGGACAGCCTCTGCTTGCTGTGG - Intronic
1184473855 22:44710375-44710397 TGGGAGGGCACTGCCTGCTGGGG + Intronic
1184562708 22:45272674-45272696 TGGTCAGGCACTGCCTGGGATGG + Intergenic
1184859217 22:47163680-47163702 GGGACAGGCACTGCCTCTGAGGG + Intronic
1184893622 22:47394233-47394255 GGGACAGACACTGCCAGCTGTGG + Intergenic
1184914913 22:47562770-47562792 TGGCCAGGCACTGACTTCTGGGG - Intergenic
1185043570 22:48517841-48517863 TGGGCAGGCACGGCCGGGTGGGG + Intronic
1185268980 22:49919516-49919538 TGAAAAGCCACTGTCTGTTGAGG - Intronic
1185277596 22:49956574-49956596 GGGGCAGGCGATGCCTGTTGTGG - Intergenic
1185334586 22:50265901-50265923 TGGCCAGGCACTGCTTGCTGGGG + Intronic
1185334621 22:50265993-50266015 TGGCCAGGCACTGCTTGCTGGGG + Intronic
954315395 3:49798730-49798752 TGGCCAGGCACAGCCTGAAGAGG - Intronic
954923099 3:54208663-54208685 TGGACAGGCACATCCAGTTCTGG + Intronic
961333850 3:126158559-126158581 AGGACAGGCTTTGCCTGATGTGG - Exonic
962440887 3:135415212-135415234 TGGACTGACACTGCCTCCTGAGG + Intergenic
964575180 3:158158361-158158383 TGGTCATGCACTGGCGGTTGTGG + Intronic
967144665 3:186596640-186596662 TGAAAGGGCACTGCCTGCTGTGG + Intronic
969114520 4:4862804-4862826 TGGACAGGTACTGCTTCTGGCGG - Exonic
969211662 4:5692525-5692547 TGGAGAGGGAATGCATGTTGTGG - Intronic
969482584 4:7454600-7454622 GGGTCAGGCACTGTGTGTTGGGG + Intronic
969482693 4:7455141-7455163 CGGTCAGGCACTGTGTGTTGGGG + Intronic
969482718 4:7455253-7455275 GGGTCAGGCACTGTGTGTTGGGG + Intronic
972726053 4:41747055-41747077 GGGACAGGAAGTGCCTGTGGTGG - Intronic
973547295 4:51994825-51994847 TGAAGAGGCAGTGCCTGATGAGG - Exonic
973555408 4:52076964-52076986 TGGACGCGCAGTGCCTGCTGCGG + Exonic
977614673 4:99074913-99074935 TGGAAAGGCACTGCCTTTGGAGG - Exonic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
984543443 4:181070046-181070068 TGTATAAGCACTGCCTTTTGAGG + Intergenic
984556119 4:181216109-181216131 AGGCCAGGCACAGCGTGTTGGGG - Intergenic
984747657 4:183238635-183238657 TGCACAAGCTCTTCCTGTTGAGG + Intronic
995712799 5:115052102-115052124 GGCACAGGCACAGACTGTTGAGG - Intergenic
997846560 5:137291695-137291717 TGGACATGCCCTGCCTGGAGTGG + Intronic
998609586 5:143673573-143673595 TGGACAGTCACTGTTTGTTGAGG + Intergenic
999291614 5:150429619-150429641 TGGAGAGGCAAGGCCTGCTGGGG + Intergenic
1002875794 6:1207771-1207793 GGGGCAGGCACTGCCTTCTGTGG + Intergenic
1004162294 6:13225373-13225395 TGGCCAATGACTGCCTGTTGGGG - Intronic
1004280479 6:14275806-14275828 TGGAAGGGCCCTGCCTGTGGGGG + Intergenic
1006340895 6:33446471-33446493 AGCACAGCCACTGCATGTTGAGG - Intronic
1006575852 6:35045052-35045074 TAGACAGGCATTGCCTTTGGAGG + Intronic
1007065937 6:38990650-38990672 TTGTCATGCACTGCCTGTGGTGG + Intronic
1007245014 6:40455232-40455254 TGCACAGGCATTGCATATTGAGG - Intronic
1009603608 6:65837093-65837115 TGGAAAGGAACTGCCTTTGGAGG - Intergenic
1013351507 6:109310066-109310088 TGGGCAGGCACTGCCTCCTCTGG + Intergenic
1014531932 6:122569160-122569182 TGGAGGGGCACAGCCAGTTGGGG - Intronic
1016635686 6:146287594-146287616 GGGACTGGCACATCCTGTTGGGG - Intronic
1016674567 6:146749056-146749078 TTCACTGTCACTGCCTGTTGTGG - Intronic
1017976716 6:159364489-159364511 TTGAAGGGCACGGCCTGTTGCGG + Intergenic
1018906100 6:168076994-168077016 TGGACAGGAACCCTCTGTTGGGG - Intronic
1019168186 6:170112907-170112929 TGCACAGTGACTGCCTGTTTAGG + Intergenic
1019508801 7:1406815-1406837 AGGACAGGCACGGCCTTGTGGGG - Intergenic
1020096133 7:5370644-5370666 AGTACAGGCACGGCCTCTTGGGG + Exonic
1020176492 7:5886311-5886333 TTTAGAGGCATTGCCTGTTGGGG - Exonic
1020894329 7:13920625-13920647 TGGACAGGGACTGCATTTTAAGG - Intronic
1022497886 7:30864693-30864715 TGGGCAGTGACTGCCTTTTGGGG - Intronic
1024970683 7:55067002-55067024 TGGCCAGCCACTGCATGGTGGGG - Intronic
1027050716 7:75019625-75019647 AGGACAGGCCCAGTCTGTTGAGG + Intronic
1029082338 7:97984714-97984736 TTTAGAGGCATTGCCTGTTGGGG + Exonic
1029617372 7:101667589-101667611 TGGACAGGAAATGCCTGCGGTGG + Intergenic
1031438696 7:121765124-121765146 TGGACAGGAACTGCCTGAAGGGG + Intergenic
1032337575 7:131040603-131040625 TATACAGGCACTCCCTCTTGTGG + Intergenic
1034838283 7:154372420-154372442 AGCACAGGCACTGCGTGTTGGGG - Intronic
1036186885 8:6629931-6629953 TACACAGCCACTGACTGTTGTGG + Intronic
1040284768 8:46094106-46094128 TGGCCCGCCACTGCCTGTGGGGG - Intergenic
1042838298 8:73097553-73097575 TGGAAAGGTACTGCCTGTATAGG + Intronic
1044370810 8:91408573-91408595 CTGACAGGCACTGCCTCTTTGGG - Intergenic
1048376301 8:133825500-133825522 TGGACAGGGACTTTCTGTTCAGG + Intergenic
1049014349 8:139908900-139908922 TGAACAGGAACAGTCTGTTGTGG - Intronic
1049206558 8:141366349-141366371 TGGACAGGCCCAGCCTCCTGCGG + Intronic
1049497156 8:142941426-142941448 TGAACAGGCGCTGCCTCCTGGGG + Intergenic
1050618635 9:7429534-7429556 TAGACAGGCAGTACTTGTTGTGG - Intergenic
1053372162 9:37571552-37571574 AGGAGAGGCACAGCCTGGTGAGG - Intronic
1055545004 9:77361245-77361267 TGCACAGGCAGTTCCTTTTGGGG - Intronic
1060247373 9:121957789-121957811 TGGCCAGGAACAGCCAGTTGGGG + Intronic
1203739241 Un_GL000216v2:164199-164221 TGTCCAGGCACTGCCTATAGGGG + Intergenic
1186265287 X:7825937-7825959 TGGAGAGGCACTGCCATGTGTGG + Intergenic
1186859368 X:13656168-13656190 TGGACAGACACTGGCTGCTAGGG - Intronic
1190708643 X:53049852-53049874 TGGGCAGGCTCAGCCTCTTGCGG + Intronic
1198643018 X:138777323-138777345 TGGACAAGGTCTGCTTGTTGGGG - Intronic
1199965120 X:152813369-152813391 TAGACAGGCACTGACTGTTCTGG - Intergenic