ID: 1082785518

View in Genome Browser
Species Human (GRCh38)
Location 11:57314167-57314189
Sequence CACATGAGCTTTGGGTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082785518_1082785523 4 Left 1082785518 11:57314167-57314189 CCACTCAACCCAAAGCTCATGTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1082785523 11:57314194-57314216 TCTCCTCAGAGGCCACAGTTCGG 0: 1
1: 1
2: 4
3: 20
4: 235
1082785518_1082785522 -7 Left 1082785518 11:57314167-57314189 CCACTCAACCCAAAGCTCATGTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1082785522 11:57314183-57314205 TCATGTGAGGATCTCCTCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 108
1082785518_1082785529 30 Left 1082785518 11:57314167-57314189 CCACTCAACCCAAAGCTCATGTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1082785529 11:57314220-57314242 CCATAACACCTGCTTTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1082785518_1082785524 5 Left 1082785518 11:57314167-57314189 CCACTCAACCCAAAGCTCATGTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1082785524 11:57314195-57314217 CTCCTCAGAGGCCACAGTTCGGG 0: 1
1: 0
2: 2
3: 32
4: 233
1082785518_1082785525 6 Left 1082785518 11:57314167-57314189 CCACTCAACCCAAAGCTCATGTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1082785525 11:57314196-57314218 TCCTCAGAGGCCACAGTTCGGGG 0: 1
1: 0
2: 0
3: 14
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082785518 Original CRISPR CACATGAGCTTTGGGTTGAG TGG (reversed) Intronic