ID: 1082785520

View in Genome Browser
Species Human (GRCh38)
Location 11:57314175-57314197
Sequence GAGATCCTCACATGAGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082785520_1082785524 -3 Left 1082785520 11:57314175-57314197 CCCAAAGCTCATGTGAGGATCTC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1082785524 11:57314195-57314217 CTCCTCAGAGGCCACAGTTCGGG 0: 1
1: 0
2: 2
3: 32
4: 233
1082785520_1082785525 -2 Left 1082785520 11:57314175-57314197 CCCAAAGCTCATGTGAGGATCTC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1082785525 11:57314196-57314218 TCCTCAGAGGCCACAGTTCGGGG 0: 1
1: 0
2: 0
3: 14
4: 179
1082785520_1082785531 29 Left 1082785520 11:57314175-57314197 CCCAAAGCTCATGTGAGGATCTC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1082785531 11:57314227-57314249 ACCTGCTTTATAAAGGGAAAAGG 0: 1
1: 0
2: 4
3: 26
4: 701
1082785520_1082785529 22 Left 1082785520 11:57314175-57314197 CCCAAAGCTCATGTGAGGATCTC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1082785529 11:57314220-57314242 CCATAACACCTGCTTTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1082785520_1082785523 -4 Left 1082785520 11:57314175-57314197 CCCAAAGCTCATGTGAGGATCTC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1082785523 11:57314194-57314216 TCTCCTCAGAGGCCACAGTTCGG 0: 1
1: 1
2: 4
3: 20
4: 235
1082785520_1082785530 23 Left 1082785520 11:57314175-57314197 CCCAAAGCTCATGTGAGGATCTC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1082785530 11:57314221-57314243 CATAACACCTGCTTTATAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082785520 Original CRISPR GAGATCCTCACATGAGCTTT GGG (reversed) Intronic