ID: 1082785521

View in Genome Browser
Species Human (GRCh38)
Location 11:57314176-57314198
Sequence GGAGATCCTCACATGAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082785521_1082785524 -4 Left 1082785521 11:57314176-57314198 CCAAAGCTCATGTGAGGATCTCC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1082785524 11:57314195-57314217 CTCCTCAGAGGCCACAGTTCGGG 0: 1
1: 0
2: 2
3: 32
4: 233
1082785521_1082785525 -3 Left 1082785521 11:57314176-57314198 CCAAAGCTCATGTGAGGATCTCC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1082785525 11:57314196-57314218 TCCTCAGAGGCCACAGTTCGGGG 0: 1
1: 0
2: 0
3: 14
4: 179
1082785521_1082785530 22 Left 1082785521 11:57314176-57314198 CCAAAGCTCATGTGAGGATCTCC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1082785530 11:57314221-57314243 CATAACACCTGCTTTATAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 281
1082785521_1082785523 -5 Left 1082785521 11:57314176-57314198 CCAAAGCTCATGTGAGGATCTCC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1082785523 11:57314194-57314216 TCTCCTCAGAGGCCACAGTTCGG 0: 1
1: 1
2: 4
3: 20
4: 235
1082785521_1082785529 21 Left 1082785521 11:57314176-57314198 CCAAAGCTCATGTGAGGATCTCC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1082785529 11:57314220-57314242 CCATAACACCTGCTTTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1082785521_1082785531 28 Left 1082785521 11:57314176-57314198 CCAAAGCTCATGTGAGGATCTCC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1082785531 11:57314227-57314249 ACCTGCTTTATAAAGGGAAAAGG 0: 1
1: 0
2: 4
3: 26
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082785521 Original CRISPR GGAGATCCTCACATGAGCTT TGG (reversed) Intronic