ID: 1082785526

View in Genome Browser
Species Human (GRCh38)
Location 11:57314197-57314219
Sequence ACCCCGAACTGTGGCCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082785526_1082785529 0 Left 1082785526 11:57314197-57314219 CCTCAGAGGCCACAGTTCGGGGT 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1082785529 11:57314220-57314242 CCATAACACCTGCTTTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1082785526_1082785530 1 Left 1082785526 11:57314197-57314219 CCTCAGAGGCCACAGTTCGGGGT 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1082785530 11:57314221-57314243 CATAACACCTGCTTTATAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 281
1082785526_1082785533 23 Left 1082785526 11:57314197-57314219 CCTCAGAGGCCACAGTTCGGGGT 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1082785533 11:57314243-57314265 GAAAAGGAACATTGTGAATCTGG 0: 1
1: 0
2: 1
3: 23
4: 248
1082785526_1082785531 7 Left 1082785526 11:57314197-57314219 CCTCAGAGGCCACAGTTCGGGGT 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1082785531 11:57314227-57314249 ACCTGCTTTATAAAGGGAAAAGG 0: 1
1: 0
2: 4
3: 26
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082785526 Original CRISPR ACCCCGAACTGTGGCCTCTG AGG (reversed) Intronic