ID: 1082785527

View in Genome Browser
Species Human (GRCh38)
Location 11:57314206-57314228
Sequence GTGTTATGGACCCCGAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082785527_1082785530 -8 Left 1082785527 11:57314206-57314228 CCACAGTTCGGGGTCCATAACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1082785530 11:57314221-57314243 CATAACACCTGCTTTATAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 281
1082785527_1082785533 14 Left 1082785527 11:57314206-57314228 CCACAGTTCGGGGTCCATAACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1082785533 11:57314243-57314265 GAAAAGGAACATTGTGAATCTGG 0: 1
1: 0
2: 1
3: 23
4: 248
1082785527_1082785531 -2 Left 1082785527 11:57314206-57314228 CCACAGTTCGGGGTCCATAACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1082785531 11:57314227-57314249 ACCTGCTTTATAAAGGGAAAAGG 0: 1
1: 0
2: 4
3: 26
4: 701
1082785527_1082785529 -9 Left 1082785527 11:57314206-57314228 CCACAGTTCGGGGTCCATAACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1082785529 11:57314220-57314242 CCATAACACCTGCTTTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082785527 Original CRISPR GTGTTATGGACCCCGAACTG TGG (reversed) Intronic