ID: 1082785527

View in Genome Browser
Species Human (GRCh38)
Location 11:57314206-57314228
Sequence GTGTTATGGACCCCGAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082785527_1082785531 -2 Left 1082785527 11:57314206-57314228 CCACAGTTCGGGGTCCATAACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1082785531 11:57314227-57314249 ACCTGCTTTATAAAGGGAAAAGG 0: 1
1: 0
2: 4
3: 26
4: 701
1082785527_1082785533 14 Left 1082785527 11:57314206-57314228 CCACAGTTCGGGGTCCATAACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1082785533 11:57314243-57314265 GAAAAGGAACATTGTGAATCTGG 0: 1
1: 0
2: 1
3: 23
4: 248
1082785527_1082785530 -8 Left 1082785527 11:57314206-57314228 CCACAGTTCGGGGTCCATAACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1082785530 11:57314221-57314243 CATAACACCTGCTTTATAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 281
1082785527_1082785529 -9 Left 1082785527 11:57314206-57314228 CCACAGTTCGGGGTCCATAACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1082785529 11:57314220-57314242 CCATAACACCTGCTTTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082785527 Original CRISPR GTGTTATGGACCCCGAACTG TGG (reversed) Intronic
900865529 1:5266218-5266240 GTGTTAGGGATCCCGAGCAGAGG + Intergenic
902996969 1:20233328-20233350 AAGTTAGGGACCCCGAACAGAGG - Intergenic
903538589 1:24083625-24083647 GTGGTATGGAGCCTGAACTCAGG + Intronic
903848662 1:26293358-26293380 GTTTTATGGACCCAAATCTGTGG + Intronic
913187767 1:116385558-116385580 GAGTTATGAACCAGGAACTGTGG - Intronic
915222616 1:154387033-154387055 GTGTTCTGGCCCCCGAAAGGAGG + Intergenic
916293018 1:163187376-163187398 GAGTTATGAACCAGGAACTGTGG - Intronic
919253898 1:195096643-195096665 TTGTTATGGACTCAGAACAGAGG - Intergenic
920453650 1:206080537-206080559 GTGTTATCGACCTCGATCAGAGG + Intronic
924071652 1:240286179-240286201 GTGTTCTGGACCCTAAATTGGGG + Intronic
1076681277 10:132172736-132172758 GGGTTATGGACCCCGCCTTGTGG - Intronic
1082785527 11:57314206-57314228 GTGTTATGGACCCCGAACTGTGG - Intronic
1097425522 12:59439777-59439799 AAGTCAGGGACCCCGAACTGAGG + Intergenic
1113957225 13:114105295-114105317 GTGCCATGGACCCTGCACTGAGG + Intronic
1114015854 14:18428392-18428414 GTGTTCTGGAATCCTAACTGAGG + Intergenic
1128699109 15:69791049-69791071 GTGTTATGCACCATGAACGGTGG + Intergenic
1134000872 16:10781800-10781822 GTGTTCTGGACCGTGAACAGAGG - Intronic
1136003184 16:27311732-27311754 GTGTAATAAACCCCGTACTGGGG - Intergenic
1137670303 16:50274630-50274652 GTGTCATGGAGGCCAAACTGGGG + Intronic
1141443211 16:84042531-84042553 GTGGTAAGGACCAGGAACTGGGG - Intronic
1146641236 17:34543051-34543073 AGGATATGGACCCTGAACTGAGG + Intergenic
1156163888 18:34394569-34394591 ATTTTATGGACCCCGAGTTGAGG + Intergenic
1159219056 18:65436512-65436534 GTGTGATGGAAACCCAACTGTGG + Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
1168129105 19:54306085-54306107 ATGTCCTGGACCCCGAACTGAGG + Intergenic
927825301 2:26304791-26304813 GACTTATGGACCCGGAATTGTGG - Intergenic
937177435 2:119954383-119954405 GTTATCTGGACCCAGAACTGAGG - Intronic
939117560 2:138077716-138077738 GAGTTTTGGACCTGGAACTGCGG - Intergenic
945813273 2:214573672-214573694 TTGTTCTGGACTCAGAACTGAGG - Intronic
1180440363 22:15359265-15359287 GTGTTCTGGAATCCTAACTGAGG + Intergenic
965280711 3:166748278-166748300 GTCTTATCGATCCCCAACTGTGG - Intergenic
981624316 4:146738584-146738606 GAGTTATGAACCGGGAACTGTGG - Intronic
981741292 4:148004735-148004757 GTATTCTGGACGCTGAACTGGGG - Intronic
982946455 4:161630135-161630157 GTTTTATGGACCTGGAACGGAGG - Intronic
986561104 5:9061579-9061601 GTGCTAGGGACCCTGAGCTGCGG + Intronic
987583345 5:19823480-19823502 AAGTTAGGGACCCCGAACGGAGG - Intronic
991296524 5:65087103-65087125 GTGTCTTTGACCCCGAACAGTGG + Intergenic
993257460 5:85610713-85610735 GTCTTTTGGACTCCAAACTGAGG - Intergenic
995429030 5:112054195-112054217 GTGTTATGGACAATCAACTGAGG + Intergenic
998879621 5:146632968-146632990 GTGTAATGGACACCAACCTGGGG - Intronic
1010284990 6:74066527-74066549 GTGTTATGGTCCCTAAAATGTGG + Intergenic
1011223026 6:85077675-85077697 GAATTATAGACCCCCAACTGAGG + Intergenic
1011391207 6:86855273-86855295 GTGTTATGGGCCAGGAACTGGGG + Intergenic
1012891099 6:104898316-104898338 GTGTTATGGAACCCCAGCTATGG - Intergenic
1023519785 7:41038810-41038832 GTGATATTGACCTCGAAATGGGG + Intergenic
1037522869 8:19697280-19697302 GTCTTACTGACCCTGAACTGAGG + Intronic
1046028749 8:108757173-108757195 GTGTTTTAGACCCCAAATTGGGG - Intronic
1203440464 Un_GL000219v1:3009-3031 GTGTTGTGGAACCCTATCTGAGG + Intergenic
1203440525 Un_GL000219v1:3633-3655 GTGTTCTGGACACCTATCTGTGG + Intergenic
1203493417 Un_GL000224v1:128202-128224 GTGTTCTGGAAACCTAACTGTGG - Intergenic
1203496103 Un_GL000224v1:153013-153035 GTGTTCTGGAATCCTAACTGAGG + Intergenic
1203498033 Un_GL000224v1:171447-171469 GTGTTCTGGAATCCTAACTGAGG + Intergenic
1203498331 Un_GL000224v1:174414-174436 GTGTTCTGGAATCCTAACTGAGG + Intergenic
1203498817 Un_GL000224v1:179152-179174 GTGTTGTGGAACCCTATCTGAGG + Intergenic
1203506037 Un_KI270741v1:70077-70099 GTGTTCTGGAAACCTAACTGTGG - Intergenic
1203508725 Un_KI270741v1:94936-94958 GTGTTCTGGAATCCTAACTGAGG + Intergenic
1203510587 Un_KI270741v1:113697-113719 GTGTTCTGGAATCCTAACTGAGG + Intergenic
1203510884 Un_KI270741v1:116663-116685 GTGTTCTGGAATCCTAACTGAGG + Intergenic
1203511343 Un_KI270741v1:121392-121414 GTGTTGTGGAACCCTATCTGAGG + Intergenic
1203511404 Un_KI270741v1:122016-122038 GTGTTCTGGACACCTATCTGTGG + Intergenic
1186143524 X:6602268-6602290 GAGTTATGACCCCGGAACTGTGG - Intergenic
1196867301 X:120081776-120081798 GACTTATGGACCCAGAATTGGGG + Intergenic
1196875798 X:120154506-120154528 GACTTATGGACCCAGAATTGGGG - Intergenic