ID: 1082785529

View in Genome Browser
Species Human (GRCh38)
Location 11:57314220-57314242
Sequence CCATAACACCTGCTTTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082785521_1082785529 21 Left 1082785521 11:57314176-57314198 CCAAAGCTCATGTGAGGATCTCC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1082785529 11:57314220-57314242 CCATAACACCTGCTTTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1082785527_1082785529 -9 Left 1082785527 11:57314206-57314228 CCACAGTTCGGGGTCCATAACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1082785529 11:57314220-57314242 CCATAACACCTGCTTTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1082785520_1082785529 22 Left 1082785520 11:57314175-57314197 CCCAAAGCTCATGTGAGGATCTC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1082785529 11:57314220-57314242 CCATAACACCTGCTTTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1082785526_1082785529 0 Left 1082785526 11:57314197-57314219 CCTCAGAGGCCACAGTTCGGGGT 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1082785529 11:57314220-57314242 CCATAACACCTGCTTTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1082785518_1082785529 30 Left 1082785518 11:57314167-57314189 CCACTCAACCCAAAGCTCATGTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1082785529 11:57314220-57314242 CCATAACACCTGCTTTATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082785529 Original CRISPR CCATAACACCTGCTTTATAA AGG Intronic