ID: 1082785530 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:57314221-57314243 |
Sequence | CATAACACCTGCTTTATAAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 317 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 33, 4: 281} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1082785520_1082785530 | 23 | Left | 1082785520 | 11:57314175-57314197 | CCCAAAGCTCATGTGAGGATCTC | 0: 1 1: 0 2: 1 3: 10 4: 101 |
||
Right | 1082785530 | 11:57314221-57314243 | CATAACACCTGCTTTATAAAGGG | 0: 1 1: 0 2: 2 3: 33 4: 281 |
||||
1082785527_1082785530 | -8 | Left | 1082785527 | 11:57314206-57314228 | CCACAGTTCGGGGTCCATAACAC | 0: 1 1: 0 2: 0 3: 2 4: 60 |
||
Right | 1082785530 | 11:57314221-57314243 | CATAACACCTGCTTTATAAAGGG | 0: 1 1: 0 2: 2 3: 33 4: 281 |
||||
1082785526_1082785530 | 1 | Left | 1082785526 | 11:57314197-57314219 | CCTCAGAGGCCACAGTTCGGGGT | 0: 1 1: 0 2: 0 3: 16 4: 133 |
||
Right | 1082785530 | 11:57314221-57314243 | CATAACACCTGCTTTATAAAGGG | 0: 1 1: 0 2: 2 3: 33 4: 281 |
||||
1082785521_1082785530 | 22 | Left | 1082785521 | 11:57314176-57314198 | CCAAAGCTCATGTGAGGATCTCC | 0: 1 1: 0 2: 2 3: 7 4: 106 |
||
Right | 1082785530 | 11:57314221-57314243 | CATAACACCTGCTTTATAAAGGG | 0: 1 1: 0 2: 2 3: 33 4: 281 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1082785530 | Original CRISPR | CATAACACCTGCTTTATAAA GGG | Intronic | ||