ID: 1082785531

View in Genome Browser
Species Human (GRCh38)
Location 11:57314227-57314249
Sequence ACCTGCTTTATAAAGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 701}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082785521_1082785531 28 Left 1082785521 11:57314176-57314198 CCAAAGCTCATGTGAGGATCTCC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 1082785531 11:57314227-57314249 ACCTGCTTTATAAAGGGAAAAGG 0: 1
1: 0
2: 4
3: 26
4: 701
1082785520_1082785531 29 Left 1082785520 11:57314175-57314197 CCCAAAGCTCATGTGAGGATCTC 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1082785531 11:57314227-57314249 ACCTGCTTTATAAAGGGAAAAGG 0: 1
1: 0
2: 4
3: 26
4: 701
1082785527_1082785531 -2 Left 1082785527 11:57314206-57314228 CCACAGTTCGGGGTCCATAACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1082785531 11:57314227-57314249 ACCTGCTTTATAAAGGGAAAAGG 0: 1
1: 0
2: 4
3: 26
4: 701
1082785526_1082785531 7 Left 1082785526 11:57314197-57314219 CCTCAGAGGCCACAGTTCGGGGT 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1082785531 11:57314227-57314249 ACCTGCTTTATAAAGGGAAAAGG 0: 1
1: 0
2: 4
3: 26
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082785531 Original CRISPR ACCTGCTTTATAAAGGGAAA AGG Intronic