ID: 1082785533

View in Genome Browser
Species Human (GRCh38)
Location 11:57314243-57314265
Sequence GAAAAGGAACATTGTGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082785526_1082785533 23 Left 1082785526 11:57314197-57314219 CCTCAGAGGCCACAGTTCGGGGT 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1082785533 11:57314243-57314265 GAAAAGGAACATTGTGAATCTGG 0: 1
1: 0
2: 1
3: 23
4: 248
1082785532_1082785533 -8 Left 1082785532 11:57314228-57314250 CCTGCTTTATAAAGGGAAAAGGA 0: 1
1: 1
2: 0
3: 30
4: 338
Right 1082785533 11:57314243-57314265 GAAAAGGAACATTGTGAATCTGG 0: 1
1: 0
2: 1
3: 23
4: 248
1082785527_1082785533 14 Left 1082785527 11:57314206-57314228 CCACAGTTCGGGGTCCATAACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1082785533 11:57314243-57314265 GAAAAGGAACATTGTGAATCTGG 0: 1
1: 0
2: 1
3: 23
4: 248
1082785528_1082785533 0 Left 1082785528 11:57314220-57314242 CCATAACACCTGCTTTATAAAGG 0: 1
1: 0
2: 3
3: 11
4: 197
Right 1082785533 11:57314243-57314265 GAAAAGGAACATTGTGAATCTGG 0: 1
1: 0
2: 1
3: 23
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082785533 Original CRISPR GAAAAGGAACATTGTGAATC TGG Intronic