ID: 1082787635

View in Genome Browser
Species Human (GRCh38)
Location 11:57325499-57325521
Sequence CTTTTGTTCTTACGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082787635_1082787639 17 Left 1082787635 11:57325499-57325521 CCTTCTTCCCGTAAGAACAAAAG No data
Right 1082787639 11:57325539-57325561 TACTTTGTTGCACCACCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082787635 Original CRISPR CTTTTGTTCTTACGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr