ID: 1082792560

View in Genome Browser
Species Human (GRCh38)
Location 11:57356803-57356825
Sequence ATGATGAAGAAAATGGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1273
Summary {0: 1, 1: 1, 2: 5, 3: 405, 4: 861}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082792560_1082792563 -7 Left 1082792560 11:57356803-57356825 CCATAATCCATTTTCTTCATCAT 0: 1
1: 1
2: 5
3: 405
4: 861
Right 1082792563 11:57356819-57356841 TCATCATTTTTAGGTTTCAGTGG 0: 1
1: 0
2: 1
3: 29
4: 292
1082792560_1082792564 19 Left 1082792560 11:57356803-57356825 CCATAATCCATTTTCTTCATCAT 0: 1
1: 1
2: 5
3: 405
4: 861
Right 1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG 0: 1
1: 0
2: 0
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082792560 Original CRISPR ATGATGAAGAAAATGGATTA TGG (reversed) Intronic
900663980 1:3801289-3801311 ATCAGGCAGAAATTGGATTAAGG - Intergenic
900841007 1:5048581-5048603 GTGAGGAAGAAAATAGATTTTGG - Intergenic
903353053 1:22729815-22729837 GTGATGAAGCAATTGGATCATGG - Intronic
903434586 1:23337246-23337268 ATGAGGAAGAGTATGAATTAGGG + Intronic
903729633 1:25482709-25482731 ATGGTGAAGAGAATGGACTCTGG + Intronic
904711859 1:32436072-32436094 ATGAGGAAGAAAATAGATTTTGG - Intergenic
904996262 1:34633933-34633955 ATGAGAAAGAAAATAGATTTTGG + Intergenic
905060259 1:35134096-35134118 GTGAGGAAGAAAATAGATTTTGG + Intergenic
905314135 1:37070294-37070316 AGGCAGAGGAAAATGGATTACGG + Intergenic
905477406 1:38238807-38238829 ATGATTAAGTAAATGAATGACGG + Intergenic
905500007 1:38428803-38428825 ATGAGGAAGAAAATAGATTTTGG - Intergenic
905608430 1:39326081-39326103 CTGATCAAGAATATGGATTGTGG + Intronic
905810154 1:40906779-40906801 ATTTTGAAGAAAATGCTTTAAGG + Intergenic
906081143 1:43089237-43089259 GTGAGGAAGAAAATAGATTTTGG - Intergenic
906087124 1:43145421-43145443 AGGATGAAGAAAATGGAGTCTGG - Intronic
906118755 1:43373431-43373453 ATGAGGAAAAAAATGGAAAAAGG + Intergenic
906200458 1:43956919-43956941 CTGATGAGGAATATGGATTCTGG + Exonic
906359879 1:45145935-45145957 CTCATGAAGAAAATGAATCAAGG + Intronic
906706603 1:47899640-47899662 TTGAAGAAGAAAAAGGATTTTGG + Intronic
906744291 1:48210958-48210980 ATGAGGAAGAAAATAGATTTTGG + Intergenic
906871784 1:49490742-49490764 AAGAGGAAAAAAATGGATTCTGG + Intronic
907503347 1:54899844-54899866 ATGAGGAAGAAAATAGATTTTGG + Intergenic
907521486 1:55026331-55026353 ATGAGGAAGAAAATAGATTTTGG - Intergenic
907845559 1:58203100-58203122 ATGATGCAGAAAAAGGGGTAAGG + Intronic
907893217 1:58656405-58656427 ATGATGAAGGAAAGGGTTTGTGG + Exonic
907905487 1:58781294-58781316 ATGATGCAGAAAAGAGGTTAGGG + Exonic
908461487 1:64351942-64351964 ATGAGGAAGAAAATAGATTTTGG + Intergenic
908852634 1:68390000-68390022 ATGAGGAAGAAAATAGATTTTGG - Intergenic
909035693 1:70592026-70592048 ATGAGGAAGAAAATAGATTTTGG - Intergenic
909146339 1:71938004-71938026 ATGATGAAAAAAATGAAAAAAGG + Intronic
909223435 1:72989789-72989811 ATGAGGAAGAAAATAGATTTTGG + Intergenic
909550806 1:76896751-76896773 ATGAGGAAGAAAATAGATTTTGG + Intronic
909776453 1:79490547-79490569 ATGAGGAAGAAAATAGATTTTGG + Intergenic
909788045 1:79640709-79640731 ATGAGGAAGAAAATAGATTTTGG + Intergenic
909792758 1:79698339-79698361 ATGAGGAAGAAAATAGATTTTGG + Intergenic
909910188 1:81249175-81249197 ATGAGGAAGAAAATAGATTTTGG - Intergenic
909978227 1:82069496-82069518 ATGAGGAAGAAAATAGATTTTGG + Intergenic
910049615 1:82959070-82959092 ACGAGGAAGAAAATAGATTTTGG - Intergenic
910068294 1:83180638-83180660 AGTATGAAGAAAATGCATTCTGG + Intergenic
910077343 1:83297029-83297051 ATGAAGAAAAAAATGGGTTATGG + Intergenic
911071401 1:93834718-93834740 GTGAGGAAGAAAATAGATTTTGG - Intronic
911365468 1:96932524-96932546 AGCAAGAAGAAAATGGATAAAGG + Intergenic
911400690 1:97370982-97371004 ATGTTGCAGAGTATGGATTACGG + Intronic
911510372 1:98803023-98803045 GTGAGGAAGAAAATAGATTTTGG + Intergenic
911570608 1:99513356-99513378 ATGAGGAAGAAAATAGATTTTGG - Intergenic
912813799 1:112813170-112813192 GTGAGGAAGAAAATAGATTTTGG - Intergenic
912815047 1:112822290-112822312 GTGAGGAAGAAAATCGATTTTGG + Intergenic
912939162 1:114029886-114029908 TTGAGGAAGAAAATCGATTTTGG - Intergenic
913192404 1:116424786-116424808 ATGATGAAGAAAGTTCATTTAGG + Intergenic
913245412 1:116866212-116866234 GTGAGGAAGAAAATAGATTTGGG - Intergenic
913445152 1:118943312-118943334 ATGATGAAGAAAATATTTCAGGG + Intronic
913966098 1:143378792-143378814 TGGATAAAGAAAATGTATTATGG - Intergenic
914060472 1:144204399-144204421 TGGATAAAGAAAATGTATTATGG - Intergenic
914118678 1:144761970-144761992 TGGATAAAGAAAATGTATTATGG + Intergenic
914381298 1:147118772-147118794 ACCATGAAGACAATGGACTAGGG + Intergenic
915585692 1:156842666-156842688 ATGATGAAGGTCATGGGTTAGGG - Intronic
915762647 1:158330450-158330472 ATGATTGAAAAGATGGATTAGGG + Intronic
916316745 1:163457151-163457173 ATGAAGAAGAGAGTAGATTAAGG - Intergenic
916329067 1:163594593-163594615 GTGATGAAGAAAATAGATTTTGG - Intergenic
916500334 1:165381521-165381543 ATGATAAAGAAAATGATTCAAGG - Intergenic
917196261 1:172469106-172469128 CTGTTGATGAAAATGGAATATGG + Intergenic
917535065 1:175868458-175868480 GTGGAGAAGAAAATGGATGATGG - Intergenic
917859314 1:179130805-179130827 ATGAGAAAGAAATAGGATTATGG + Intronic
917911411 1:179650837-179650859 ATGATCAAGATATTGGATTCAGG - Intronic
918258087 1:182768458-182768480 ATAATGAAGAATATAGGTTATGG + Intergenic
918347343 1:183617381-183617403 ATGAGGAAGAAAATAGATTTTGG - Intergenic
918349941 1:183644192-183644214 ATGATTAAGAACATGGATTCTGG + Intronic
918468333 1:184844789-184844811 CTTAGGAAGAAAATGGATCATGG - Intronic
918567445 1:185950273-185950295 ATGAGGAAGAAAATAGATTTTGG + Intronic
918714175 1:187767488-187767510 ATGAGGAAGAAAATAGATTTTGG + Intergenic
919036909 1:192323493-192323515 AACATGAAGAAAATAGATAATGG + Intronic
919180521 1:194075453-194075475 AGGAGGAAGAAACAGGATTATGG + Intergenic
919383817 1:196894210-196894232 ATTATGTAGAAAATGAAATATGG + Intronic
919476628 1:198038510-198038532 ATGAGGAAGAAAATAGATTTTGG - Intergenic
919937468 1:202264166-202264188 ATGAGGGAGAAAATAGATTGTGG + Intronic
920427088 1:205887075-205887097 ATGAGGAAGAAAATAGATTTTGG + Intergenic
920696742 1:208186613-208186635 GTGATGGAGAAAATGGGATAGGG + Intronic
920908276 1:210191219-210191241 GTGAGGAAGAAAATAGATTTTGG - Intergenic
921098467 1:211907703-211907725 ATGAGGAGGAAAATGGGTTCTGG + Intergenic
921459552 1:215411924-215411946 ATGAGGAAGAAAATAGATTTTGG + Intergenic
921509483 1:216011727-216011749 ATGAGGAAGAAAATAGATTTTGG - Intronic
921732751 1:218595776-218595798 ATGAGGAAGAAAATAGATTTTGG + Intergenic
921894373 1:220383969-220383991 AAGCTGAAGAAAGTGGAGTAAGG - Intergenic
922048633 1:221969671-221969693 ATGAGGAAGAAAATAGATTTTGG - Intergenic
922049313 1:221975082-221975104 ATGAGGAAGAAAATAGATTTTGG + Intergenic
922153839 1:223026383-223026405 ATGAGGAAGAAAATAGATTTTGG + Intergenic
922356660 1:224782773-224782795 TTGATGAAGAAACTGGAGGAGGG + Intergenic
922845139 1:228678775-228678797 GTGAGGAAGAAAATAGATTTTGG + Intergenic
922857518 1:228787736-228787758 ATGAATAAGAAATTGGATTTAGG + Intergenic
922877307 1:228949966-228949988 ATGAGGAAGAAAATAGACTTTGG - Intergenic
922906617 1:229178163-229178185 ATGAGGAAGAAAATAGATTTTGG - Intergenic
922935046 1:229416107-229416129 GTGAGGAAGAAAATAGATTTTGG - Intergenic
923075454 1:230605116-230605138 ATGAGGAAGAAAATAGATTTTGG - Intergenic
923153730 1:231257656-231257678 ATGATGGATAAAATGGACCAGGG - Intronic
923213971 1:231832186-231832208 GTGAGGAAGAAAATAGATTTTGG + Intronic
923244976 1:232121914-232121936 ATGAGGAAGAAAATAGATTTTGG - Intergenic
923257113 1:232231609-232231631 GTGAGGAAGAAAATAGATTTTGG + Intergenic
923297511 1:232609228-232609250 TTGATGAACAAAACGGATTCTGG - Intergenic
923408402 1:233685411-233685433 ATGAGGAAGAAAATAGATTTTGG + Intergenic
923770519 1:236934243-236934265 ATGACGAAGAAAATAGATTTTGG + Intergenic
923963011 1:239105096-239105118 ATGAGGAAGAAAATAGATTTTGG - Intergenic
924180920 1:241437913-241437935 GTGAGGAAGAAAATAGATTAAGG - Intergenic
924354041 1:243150966-243150988 ATGGTGAAGAATATGGACTCTGG - Intronic
924430035 1:243988889-243988911 AAGAAAAAGAAAATGGATTCTGG - Intergenic
924895956 1:248338210-248338232 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1062931012 10:1352672-1352694 ATGAGGAAGAAAGTAGATTTTGG - Intronic
1063363410 10:5475052-5475074 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1063509371 10:6631573-6631595 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1063527461 10:6799073-6799095 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1063936497 10:11083773-11083795 ATGATGAAGACACTGGGGTATGG - Intronic
1064128261 10:12683712-12683734 ATTATGAAGTAAATGAATTTAGG + Intronic
1064886772 10:20121146-20121168 ATGAGGAAGAAAATAGATTTTGG + Intronic
1065437885 10:25720395-25720417 ATGAGGAAGAAAACAGATTTTGG - Intergenic
1065442900 10:25770728-25770750 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1065500278 10:26374496-26374518 ATACAGAAGAAAATGGACTAAGG + Intergenic
1066322784 10:34321820-34321842 ATGATGGAGAAAATGACTTTGGG + Intronic
1066436922 10:35404111-35404133 GTGAGGAAGAAAATAGATTTTGG + Intronic
1068058126 10:52035743-52035765 ATGAGGAAGAAAATAGATTTTGG + Intronic
1068179396 10:53500800-53500822 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1068231192 10:54170488-54170510 ATGAGGAAGAAAATAGGTTTTGG - Intronic
1068361032 10:55975147-55975169 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1068515051 10:58015490-58015512 ATGGAGAAGAAAAAGGCTTAAGG - Intergenic
1068592114 10:58862993-58863015 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1068966830 10:62920545-62920567 ATGATTAAGAGCATGGATTCTGG - Intergenic
1069292801 10:66803791-66803813 GTGATTAAGAGAATGGATTTTGG - Intronic
1069514056 10:69063740-69063762 ATGAGGATCAAAATGGATCAGGG - Intergenic
1070230505 10:74561430-74561452 ATGATGAAGAATATGAATCAAGG + Intronic
1070266791 10:74910637-74910659 AGGATGCAGATAATGGAATATGG - Intronic
1070480877 10:76881773-76881795 ATCCTGAAGAACATGGATTGTGG + Intronic
1071663753 10:87532540-87532562 ATGATGAAGAAACTGGCAGATGG + Intronic
1071708507 10:88025719-88025741 ATGGAGAATAAAGTGGATTAGGG - Intergenic
1071774462 10:88769613-88769635 ATGATGGATAAAATGGATTTGGG + Intronic
1071897520 10:90083016-90083038 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1071916427 10:90298726-90298748 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1071961371 10:90811349-90811371 GTGAGGAAGAAAATAGATTTTGG - Intronic
1072011103 10:91303718-91303740 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1072510834 10:96123353-96123375 ATTATGTAGAAAATGAAATATGG + Intergenic
1072919922 10:99568197-99568219 ATGTTTAAGAACATGGATTGGGG + Intergenic
1073014236 10:100385334-100385356 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1073224511 10:101906134-101906156 ATGAACAGGAAAATGGATTGTGG - Intronic
1073683734 10:105730948-105730970 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1073709261 10:106019608-106019630 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1074019290 10:109566301-109566323 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1074461391 10:113640951-113640973 ATGATCAAAAAAATGAATGAAGG + Intronic
1074607182 10:114984618-114984640 ATTTTGCAGAAAATGGATCAAGG - Intergenic
1074741030 10:116484545-116484567 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1075248928 10:120848573-120848595 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1076022637 10:127086722-127086744 ATGATGACGAAAATGGGTCTTGG + Intronic
1076281874 10:129253165-129253187 ATGTGAAAGAAAATGGAATATGG + Intergenic
1077346814 11:2063332-2063354 TTGAAGAAAAAAATGGAGTATGG - Intergenic
1077588522 11:3473262-3473284 GTGAGGAAGAAAATAGATTTCGG + Intergenic
1077842807 11:5993434-5993456 TTGATGAAAAAAATGGGTGAGGG - Intergenic
1077850574 11:6071814-6071836 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1078130984 11:8614003-8614025 ATGATGCCGAAAATGGAGAATGG + Exonic
1078789279 11:14526564-14526586 GTGAGGAAGAAAATAGATTTTGG - Intronic
1079230779 11:18646984-18647006 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1079447686 11:20571524-20571546 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1079635525 11:22735041-22735063 ATGATGAACAAACTGAATAAAGG - Intronic
1079672343 11:23185917-23185939 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1079726859 11:23889168-23889190 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1079835766 11:25330200-25330222 GTGAAGAAGAAAATAGATTTAGG + Intergenic
1079847424 11:25488993-25489015 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1079941071 11:26681226-26681248 ATGAAGAAGAAAAAGGTTAATGG + Intronic
1080027691 11:27631059-27631081 ATGGGGAAGAAAATAGATTTTGG + Intergenic
1080530479 11:33170543-33170565 ATGATGAAGAATAGGGCATATGG - Intergenic
1081060593 11:38470572-38470594 AGGATGAAGAAAAAGGAGGAGGG - Intergenic
1082792560 11:57356803-57356825 ATGATGAAGAAAATGGATTATGG - Intronic
1084232526 11:67763396-67763418 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1084354480 11:68628249-68628271 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1084355776 11:68637433-68637455 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1084613029 11:70216104-70216126 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1085167337 11:74414542-74414564 TTGATGAAGAAAAGGCTTTATGG + Intergenic
1085924149 11:80995119-80995141 ATGCTTAAGAAAAGGGATAAAGG + Intergenic
1086134576 11:83433382-83433404 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1086550467 11:88047124-88047146 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1086660159 11:89406267-89406289 ACAGTGAAGTAAATGGATTAGGG - Intronic
1086858065 11:91890639-91890661 ATGATTAAGAACCTGGATTTTGG - Intergenic
1087099891 11:94353572-94353594 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1087128040 11:94645337-94645359 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1087167811 11:95022268-95022290 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1087197139 11:95313247-95313269 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1087314899 11:96591658-96591680 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1087348715 11:97004056-97004078 AGGATGAAAAGAATGGAATAAGG + Intergenic
1087404652 11:97715864-97715886 ATGATGGAAAAAATGAATTTTGG - Intergenic
1087696954 11:101390209-101390231 GTGGAGAAGAAAATGGATTCTGG + Intergenic
1087839280 11:102905855-102905877 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1088023133 11:105144097-105144119 AAGATGGAGAAAATAGATTCTGG - Intergenic
1088086337 11:105985112-105985134 ATGAGGAAGAAAAGAGGTTATGG - Intergenic
1088466745 11:110147803-110147825 ATGATGAAGAAGAAGGAACAAGG - Intronic
1088555211 11:111054131-111054153 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1088707441 11:112476618-112476640 GTGAGGAAGAAAGTGGATTGAGG - Intergenic
1089470837 11:118718989-118719011 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1089482074 11:118814226-118814248 AATATGAAGAAAATGGATTCAGG - Intergenic
1089866822 11:121639904-121639926 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1089953591 11:122551059-122551081 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1089987898 11:122830846-122830868 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1090714612 11:129419217-129419239 ATGATTAATAAAATGAAGTAGGG - Intronic
1090871741 11:130755492-130755514 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1090926710 11:131256473-131256495 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1091149090 11:133310102-133310124 ATGATGAAGAGAAAGGAGTCTGG + Intronic
1091183939 11:133630734-133630756 GTGAGGAAGAAAATAGATTCTGG - Intergenic
1092273614 12:7042340-7042362 ACGCTGATGAAAATGGATCAAGG - Intronic
1092414785 12:8282031-8282053 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1092626529 12:10334909-10334931 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1092723509 12:11464159-11464181 ATGAGGAAGAAAATAGATTTTGG + Intronic
1092739100 12:11611687-11611709 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1092789933 12:12062117-12062139 ATGAGGAAGAAAATAGATTTTGG - Intronic
1092924561 12:13261568-13261590 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1093181887 12:15976207-15976229 ATACTGAAGATAATGGATAATGG - Intronic
1093267822 12:17023859-17023881 ATGAGGAAGAAAGTAGATTTTGG + Intergenic
1093358712 12:18199055-18199077 GTGAGGAAGAAAATAGATTTTGG - Intronic
1093440378 12:19188348-19188370 TTTATGAAAAAAATGTATTAAGG - Intronic
1093579041 12:20767098-20767120 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1093584301 12:20818991-20819013 ATGAGGAAGAAAATAGATTTTGG + Intronic
1093619359 12:21268364-21268386 TGGATGAAGAGAATGGAGTAAGG - Exonic
1093638217 12:21496186-21496208 ATGCAGAAGACAATGGATTCTGG + Intronic
1093780113 12:23125647-23125669 AAGATGGAGAAAATGTATGAAGG + Intergenic
1093909866 12:24734387-24734409 ATTATCAAGAAAATGTCTTAAGG - Intergenic
1094257659 12:28452551-28452573 ATGCTGAAGAAAGGGAATTATGG + Exonic
1094400937 12:30059919-30059941 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1094682814 12:32680961-32680983 ATGAGGAAGTAAAAGAATTAGGG + Intronic
1094742509 12:33305910-33305932 CTGAAGAATAATATGGATTATGG + Intergenic
1094786644 12:33856261-33856283 ATGCTGGAGAAACTGGATAATGG - Intergenic
1094826018 12:34269731-34269753 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1095637864 12:44453529-44453551 ATGAAGAGGAAAATAGATTTTGG - Intergenic
1095778448 12:46034083-46034105 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1095806506 12:46325709-46325731 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1095818671 12:46452772-46452794 ATTATAAAGACAATGGATAAAGG + Intergenic
1095902587 12:47343376-47343398 AAAATGAAAAAAATGAATTATGG + Intergenic
1096906990 12:54945082-54945104 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1097398808 12:59105563-59105585 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1097416830 12:59325203-59325225 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1097463721 12:59896226-59896248 ATGATGAAGATCATGGACTTGGG + Intergenic
1097541930 12:60953755-60953777 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1097592589 12:61590594-61590616 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1097709603 12:62903489-62903511 ATGATGAATAAAATTAATTCTGG + Intronic
1097727030 12:63087267-63087289 ATGATGTAGAAGATGAATTCAGG - Intergenic
1098364818 12:69691406-69691428 ATGATTAAGAACACGGAGTAAGG - Intronic
1098402479 12:70089134-70089156 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1098597161 12:72287188-72287210 ATGAGGAAGAACAAGGATGATGG - Intronic
1098629283 12:72707086-72707108 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1098629771 12:72710667-72710689 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1098653568 12:73003783-73003805 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1099188940 12:79543595-79543617 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1099291874 12:80785061-80785083 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1099425009 12:82513322-82513344 TTAACTAAGAAAATGGATTATGG + Intergenic
1099762846 12:86942745-86942767 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1099835842 12:87909173-87909195 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1100349706 12:93768370-93768392 ATAGAGAAGAAGATGGATTATGG + Intronic
1100561582 12:95752896-95752918 ATGAGGAAGAAAATAGATTTTGG - Intronic
1100932527 12:99626580-99626602 GTCATGAAGAAGATGGAATATGG - Intronic
1101278173 12:103224659-103224681 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1101457649 12:104853591-104853613 ATGGTAAAGGTAATGGATTAGGG - Intronic
1101554259 12:105793171-105793193 ATAATGAAAAATATGTATTAAGG + Intergenic
1101680883 12:106964083-106964105 ATGATGAACAAATTGGACAAAGG + Intronic
1104036900 12:125104038-125104060 GAGATTAAGGAAATGGATTATGG + Intronic
1105032508 12:132893811-132893833 GTGAGGAAGAAAATAGATTTTGG - Intronic
1105757570 13:23482945-23482967 TTGATGAAAGAAATGGATTCTGG + Intergenic
1105893837 13:24701589-24701611 GTAATGATGAACATGGATTATGG - Intronic
1106285473 13:28314738-28314760 ATGCTGGAGAAAATGGCTGAAGG + Intronic
1106891306 13:34248815-34248837 AGGATGAAGGAAATGCATCAAGG + Intergenic
1107075805 13:36320176-36320198 ATGAGGAAGAAAATGGATTTTGG - Intronic
1107139810 13:36986084-36986106 ATGATGCTTAAAATGAATTACGG + Intronic
1107171609 13:37349125-37349147 ATTATGTAGAAAATGTATTGTGG - Intergenic
1107211763 13:37866559-37866581 ATGATGCAAAAAATGCATTTAGG - Intronic
1108779690 13:53814118-53814140 ATGATGGGGAAAATGAATAATGG - Intergenic
1108803643 13:54129665-54129687 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1108814351 13:54270593-54270615 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1108913196 13:55580221-55580243 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1108919326 13:55656942-55656964 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1108947689 13:56044250-56044272 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1108952728 13:56114399-56114421 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1109232919 13:59781073-59781095 TGGCTGAAGAAAATGGAATAAGG - Intronic
1109287678 13:60430076-60430098 AAGATGAAGTAAATTGACTAGGG + Intronic
1109343855 13:61092468-61092490 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1109353174 13:61208742-61208764 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1109499523 13:63216840-63216862 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1109709442 13:66143310-66143332 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1109716516 13:66228363-66228385 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1109837778 13:67881188-67881210 ATGATTGAAAAAAGGGATTATGG - Intergenic
1109868969 13:68305560-68305582 ATGAGGTGGAAAATGAATTAAGG + Intergenic
1109965767 13:69692665-69692687 AAGGTGGAGAAAAGGGATTAAGG + Intergenic
1110335511 13:74325614-74325636 TTGATGAAAAAAATGGTTAAAGG + Intergenic
1110347066 13:74460788-74460810 ATGATAAAGAAAAAGGATAAGGG - Intergenic
1110650232 13:77935100-77935122 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1110765709 13:79277863-79277885 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1110845569 13:80187411-80187433 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1110978708 13:81869911-81869933 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1111069895 13:83152041-83152063 ATGTGGATGAAAATGTATTAAGG - Intergenic
1111125815 13:83910262-83910284 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1111302268 13:86362139-86362161 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1111361883 13:87188401-87188423 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1111458616 13:88514808-88514830 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1111630661 13:90843170-90843192 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1111631480 13:90850567-90850589 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1112237085 13:97646239-97646261 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1112889107 13:104210085-104210107 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1113165324 13:107434082-107434104 AAGATGAAGTAAATTGACTAAGG + Intronic
1113324579 13:109269239-109269261 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1114348141 14:21819596-21819618 ATGATGCAGAAAAAGCATTTAGG - Intergenic
1114836818 14:26212386-26212408 AAGAAGAAGAAAATGGATACTGG - Intergenic
1115466310 14:33718266-33718288 AAGATAAAGACAAAGGATTAAGG - Intronic
1115721752 14:36169429-36169451 AGAATGGAGAAAATGGATTCAGG + Intergenic
1115905033 14:38194525-38194547 ATGAGGAAGAAGATAGATTTTGG - Intergenic
1116179932 14:41519890-41519912 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1116245041 14:42399521-42399543 ATGAAGAAGAAAATAGCTAAGGG + Intergenic
1116266658 14:42700175-42700197 AGGAAGAAGAAAATAGAGTAAGG + Intergenic
1116490357 14:45497360-45497382 ATGAGGAAGAAAATAGATATTGG + Intergenic
1116491462 14:45508404-45508426 ATGTTAAAGAAAATTGATTCTGG - Intergenic
1116534550 14:46014402-46014424 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1116573677 14:46547646-46547668 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1116702137 14:48257151-48257173 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1116703068 14:48264346-48264368 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1117321563 14:54628819-54628841 AGAATGAAGAACCTGGATTAAGG - Intronic
1117520755 14:56549242-56549264 AAGATGAAGTAAATAGATTAGGG - Intronic
1117743866 14:58847378-58847400 TTGAAGAATAAAATGAATTAAGG - Intergenic
1117744415 14:58853707-58853729 ATGATCAAGTCAATGTATTAGGG + Intergenic
1117801409 14:59447812-59447834 ATGAGGAAGAAAATAGATTTTGG - Intronic
1118126160 14:62907016-62907038 AAAGTTAAGAAAATGGATTAGGG - Intronic
1118553972 14:66992223-66992245 ATGATAAACAAAAAGGAATATGG + Intronic
1118936982 14:70297400-70297422 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1119022642 14:71128042-71128064 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1119317423 14:73707222-73707244 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1119560007 14:75582435-75582457 GTGAGGAAGAAAATAGATTTTGG + Intronic
1120114692 14:80601013-80601035 ATGAAGAAGAAAAATCATTAAGG + Intronic
1120245363 14:81999468-81999490 ATAATGTAGAAGATGGACTAAGG - Intergenic
1120251134 14:82062856-82062878 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1120437829 14:84502194-84502216 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1120539337 14:85734951-85734973 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1120618495 14:86735262-86735284 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1120659676 14:87236640-87236662 ATGAGGCAGAAAATAGATTTTGG + Intergenic
1120774447 14:88418135-88418157 ATGATGAAGAAGAAGAATGAAGG - Intronic
1121157217 14:91697355-91697377 GTGATAGTGAAAATGGATTAAGG + Intronic
1121389750 14:93563907-93563929 AAAATGAAGAAAATAGATTTTGG + Intronic
1121703909 14:95976894-95976916 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1121819128 14:96951686-96951708 GTGATGAAGGAAATGGATGGTGG + Intergenic
1121980379 14:98449252-98449274 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1122041219 14:98988930-98988952 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1122360820 14:101161874-101161896 ATGTTAAAGAAAATGTATTTTGG + Intergenic
1122381063 14:101307474-101307496 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1122507899 14:102243562-102243584 GTGAGGAAGAAAATAGATTTTGG - Intronic
1123893676 15:24806957-24806979 GTGATGAAGAGAATGGACTCTGG - Intergenic
1124071760 15:26401610-26401632 AAGATGCAGAAAATGCATTTAGG - Intergenic
1124454025 15:29823694-29823716 ATGAAGAACAAAAAGGAATAAGG - Intronic
1124922941 15:34044126-34044148 ATGATGCAGAAGTTGGATTAGGG - Intronic
1125227049 15:37407675-37407697 ATGTAGAAGAAAATAGATTATGG + Intergenic
1125343811 15:38699091-38699113 ATGATGCAGAATAGGGAATAGGG - Exonic
1126327309 15:47493798-47493820 ATGATCAAGAGTATGAATTATGG - Intronic
1126529926 15:49701118-49701140 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1126844026 15:52742684-52742706 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1126912188 15:53428818-53428840 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1127721613 15:61707011-61707033 ATCATGATTATAATGGATTATGG + Intergenic
1128741884 15:70089441-70089463 CTGATGAAGAAACTGGATGCTGG + Intronic
1128851194 15:70958588-70958610 CTGATGAAGAAAATGAATTTTGG + Intronic
1128919768 15:71599651-71599673 TTTATGAAGAAAATGGAGCAGGG - Intronic
1129259684 15:74357870-74357892 GTGAGGAAGAAAATAGATTTTGG - Intronic
1130214136 15:81952668-81952690 ATGGGGAAGAAAAAGGATTTTGG - Intergenic
1130304815 15:82706197-82706219 GTGAGGAAGAAAATAGATTTTGG - Intronic
1130429643 15:83833590-83833612 ATAATTAAGAAATTGGATTCTGG - Intronic
1130673601 15:85933603-85933625 ATGATGAGGAAAACAGATGACGG - Intergenic
1130772971 15:86943659-86943681 GTGATGAAGAAAAAGGAAGAGGG + Intronic
1130781331 15:87043591-87043613 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1130855329 15:87835002-87835024 ATGAGGAATAAAATAGATTTTGG - Intergenic
1130945689 15:88549268-88549290 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1131684968 15:94758411-94758433 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1131882291 15:96873799-96873821 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1131937768 15:97525719-97525741 ATGATGAAGGAAATGAAGAAAGG + Intergenic
1132263270 15:100444234-100444256 GTGAGGAAGAAAATAGATTTTGG - Intronic
1132340648 15:101076273-101076295 ATGAGGAAGAAAATAGATTTTGG - Intronic
1133081860 16:3328018-3328040 ATGAGGAAGAAAGTAGAATAGGG - Intergenic
1133623075 16:7544891-7544913 ATGATGAACAAAATGCAGTATGG - Intronic
1133671150 16:8022121-8022143 ATAAAGAATAAAATGGATAATGG + Intergenic
1133765502 16:8835008-8835030 ATGAGGAAGAAAGTAGATTTTGG + Intronic
1133766508 16:8841905-8841927 ATGAGGAAGAAAATGGATTTTGG + Intronic
1133869323 16:9673067-9673089 ATGAGTAAGAAAATAGATTTTGG + Intronic
1134065001 16:11222574-11222596 CAGAAGAAGAAAGTGGATTAGGG + Intergenic
1134571996 16:15299029-15299051 ATGAAGAAGACAATGGGATATGG - Intergenic
1134730385 16:16457014-16457036 ATGAAGAAGACAATGGGATATGG + Intergenic
1134937046 16:18254882-18254904 ATGAAGAAGACAATGGGATATGG - Intergenic
1135085479 16:19471597-19471619 TTCATGATGAACATGGATTATGG - Intronic
1135153580 16:20032192-20032214 AAGATGAAGAAGATGGAGCAGGG + Exonic
1135654132 16:24233008-24233030 ATGGTGAAAAAAATAGATGAAGG - Intergenic
1135781488 16:25305949-25305971 ATGATGAAGGAGATAGAGTATGG + Intergenic
1137896375 16:52217097-52217119 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1138251134 16:55502789-55502811 GTGAAGAAGAAAATGGATCCTGG + Exonic
1138253503 16:55529002-55529024 ATAATGAAGAAAACAGAGTAAGG - Intronic
1138758872 16:59519616-59519638 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1138805172 16:60082565-60082587 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1139039014 16:62981124-62981146 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1139225690 16:65231807-65231829 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1139230360 16:65277231-65277253 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1139325708 16:66151342-66151364 ATGAGGAAGAAAAAGGAAAAAGG + Intergenic
1139942831 16:70618460-70618482 ATGAGGAAGAAAATAGATTTTGG + Intronic
1139943496 16:70622774-70622796 ATGAGGAAGAAAATAGATTTTGG + Intronic
1140003741 16:71054287-71054309 ATGATGAGGAAAAAGGCATAAGG - Intronic
1142855728 17:2728628-2728650 AAGATGAAGACATTGGATTGGGG + Intergenic
1143414087 17:6733404-6733426 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1144435225 17:15234015-15234037 ATGGTGCAGAAAATGGATTCAGG + Intronic
1145219366 17:21075705-21075727 ATAATGAGGAAAATGTATTCTGG + Intergenic
1146077602 17:29745819-29745841 CTGATGAGGAAAAAGGTTTAGGG + Intronic
1146087208 17:29840588-29840610 ATGGTGAAGAAAATGGAAGATGG + Intronic
1146189236 17:30750234-30750256 AGGGTGAACAAAATGGATGAAGG + Intergenic
1146334125 17:31954537-31954559 AGGGTGAACAAAATGGATGAAGG + Intronic
1146507943 17:33421684-33421706 AGGAAGTAGAAAATGGATCAGGG + Intronic
1146598128 17:34187010-34187032 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1147116116 17:38301107-38301129 AGGATGAGAAAAATGGAATAAGG - Intronic
1148172654 17:45536142-45536164 ATCATGAATGAAATGGTTTATGG - Intergenic
1148276616 17:46309307-46309329 ATCATGAATGAAATGGTTTATGG + Intronic
1148298733 17:46526895-46526917 ATCATGAATGAAATGGTTTATGG + Intronic
1148363267 17:47031392-47031414 ATCATGAATGAAATGGTTTATGG + Intronic
1148364551 17:47044082-47044104 ATGATGAGCAAATTGAATTATGG + Intronic
1148413565 17:47488483-47488505 AGGATGAGAAAAATGGAATAAGG + Intergenic
1149220767 17:54413454-54413476 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1149771772 17:59328207-59328229 ATTATGAAGAAAATAAATTGGGG + Intergenic
1149795100 17:59511818-59511840 ATAGTGAAGAAAATGCATCAAGG + Intergenic
1149943061 17:60891832-60891854 ATGATGATGAAAATGGAAATAGG - Intronic
1150198424 17:63326358-63326380 AAGAATAAGCAAATGGATTAAGG + Intronic
1150403858 17:64883062-64883084 ATCATGAATGAAATGGTTTATGG - Intronic
1150879587 17:69008760-69008782 ATGATGAAAAATATGACTTACGG - Intronic
1151010336 17:70485926-70485948 ATGCTTAAGAAAACAGATTATGG - Intergenic
1153466351 18:5392004-5392026 ATAACGAAGGAAATGGATGACGG + Intergenic
1153540487 18:6148914-6148936 ATAATGAAAAAAATGGAACAGGG - Intronic
1154376454 18:13814284-13814306 ATAAAAATGAAAATGGATTAGGG - Intergenic
1155372983 18:25123355-25123377 ATGATAAAGAAAATGACATAAGG + Intronic
1155431007 18:25758013-25758035 ACCATGAAGGAAAAGGATTATGG - Intergenic
1155586050 18:27366748-27366770 ATGATGAACAAGATGAATTGTGG + Intergenic
1155635524 18:27950451-27950473 ATGATCAAGTCAATGGATAAAGG + Intergenic
1155696791 18:28695091-28695113 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1156182834 18:34625832-34625854 ATGATGAAAACAATGAATGAAGG + Intronic
1156251673 18:35358096-35358118 GTGAAGAAGAAAATAGATTTTGG + Intergenic
1156302513 18:35847864-35847886 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1156916055 18:42465348-42465370 GTGAGGAAGAAAATTGATTTTGG - Intergenic
1156916791 18:42471247-42471269 AGGATGAAGAGCATGGATTTAGG + Intergenic
1156923885 18:42554891-42554913 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1156929643 18:42626227-42626249 GTGATAAAGAAAAAGTATTAGGG + Intergenic
1156938755 18:42740381-42740403 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1156958448 18:42994822-42994844 GTGAGGAAGAAAATAGATTTTGG - Intronic
1157090375 18:44629905-44629927 ATAAAGAAGAAAATGAATAATGG - Intergenic
1157645593 18:49266278-49266300 ATGGTGAAGAAAAGAGATTTTGG - Intronic
1158172910 18:54619372-54619394 ATGATGAATCGAATAGATTAAGG - Intergenic
1158336596 18:56419328-56419350 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1158394421 18:57068608-57068630 ATGAGGAAGAACATCGATTCTGG + Intergenic
1158712153 18:59847430-59847452 GTGATGAACAGAAGGGATTAAGG - Intergenic
1159057118 18:63477127-63477149 ATGGTGAACAAAATGGACTTAGG + Intronic
1159164707 18:64685361-64685383 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1159380979 18:67658802-67658824 ATAATGAACGAAAGGGATTATGG + Intergenic
1159441062 18:68480919-68480941 TTGGTGAAGAAACTGAATTAAGG + Intergenic
1159835269 18:73328374-73328396 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1160161731 18:76478429-76478451 ATTATGAAAAAAAAGGTTTAAGG + Intronic
1160271328 18:77387004-77387026 ATAAGGAAGAAAATGGTTTCAGG - Intergenic
1160304046 18:77715156-77715178 AATATGAAGAAAATGAATTAAGG - Intergenic
1161637620 19:5398912-5398934 ATGATGCAGGAATTGGAGTAGGG + Intergenic
1162484217 19:10948902-10948924 CTGATTAAGAACATGGATTCTGG - Intergenic
1163487521 19:17597159-17597181 ATGAGGAAGCAAATAGATTTTGG - Intergenic
1163584882 19:18158091-18158113 ATGATTAAGAAAACGGGTCATGG + Intronic
1163899927 19:20092220-20092242 GTGAGGAAGAAAATAGATTTTGG + Intronic
1163907401 19:20159269-20159291 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1164153201 19:22571971-22571993 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1164202253 19:23028624-23028646 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1164959509 19:32415623-32415645 GTGATGTGGAAAATGGATTTGGG + Intronic
1164970699 19:32529977-32529999 ATAATGAAGAAATTGTATTTTGG - Intergenic
1165496778 19:36157401-36157423 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1165510097 19:36261468-36261490 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1165667176 19:37642490-37642512 ATTATGAAGAAAAGTGAGTAAGG - Intronic
1165835587 19:38753342-38753364 GTGAGGAAGAAAATAGATTTTGG - Intronic
1166043744 19:40217801-40217823 TTGATCAAGGAAAGGGATTAGGG - Intronic
1166498708 19:43325487-43325509 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1166581097 19:43900711-43900733 ATTATGAAGAGAAGGGCTTAAGG + Intronic
1166905497 19:46105665-46105687 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1166926872 19:46275102-46275124 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1167046388 19:47051800-47051822 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1167099691 19:47396771-47396793 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1167901394 19:52624837-52624859 GTGAGGAAGAAAATAGATTTGGG - Intronic
1167902375 19:52631505-52631527 ATGAGGAAGAAAATAGATTTTGG - Intronic
1168051865 19:53835333-53835355 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1202699878 1_KI270712v1_random:156286-156308 TGGATAAAGAAAATGTATTATGG - Intergenic
925433567 2:3817496-3817518 GTGAGGAAGAAAATAGATTTTGG + Intronic
925544774 2:5004713-5004735 ATGAGGAAGAAAATAGATTTTGG - Intergenic
925654889 2:6135936-6135958 ATAAAAAAGAAAATGGGTTAGGG + Intergenic
925828601 2:7874680-7874702 ATGAGGAAGAAAATAGATTTTGG + Intergenic
926407988 2:12573487-12573509 ATGAGGAAGAAAATAGATTTTGG - Intergenic
926413814 2:12630235-12630257 ATGAGGAAGAAAATAGACTTTGG - Intergenic
926463864 2:13165971-13165993 ATGAGGAAGAAAATAGATTTTGG + Intergenic
926815320 2:16793915-16793937 ATGAGGAAGAAAATAGATTTTGG + Intergenic
926972329 2:18479400-18479422 TTAATGAAGAAAATGGCTTGTGG - Intergenic
927034359 2:19158288-19158310 AAGAGGAAGAAACTGGATAAAGG - Intergenic
927672071 2:25076986-25077008 ATGCTGATGAAAATGAATTTGGG - Intronic
928332655 2:30369536-30369558 ATGATTGAGAAAATGACTTAAGG - Intergenic
928625571 2:33136294-33136316 ATGATCAGGAAACTGGATTCTGG + Intronic
928770594 2:34699086-34699108 GTGAAGAAGAAAATAGATTTTGG + Intergenic
928771021 2:34702081-34702103 GTGAGGAAGAAAATAGATTTTGG - Intergenic
928778530 2:34793440-34793462 GTGAGGAAGAAAATAGATTTTGG - Intergenic
928779485 2:34802947-34802969 GTGAGGAAGAAAATAGATTTTGG + Intergenic
928827405 2:35438868-35438890 GTGAGGAAGAAAATAGATTTTGG + Intergenic
928857395 2:35816819-35816841 GTGAGGAAGAAAATAGATTTTGG - Intergenic
929004577 2:37382767-37382789 GTGAGGAAGAAAATAGATTTTGG + Intergenic
929076447 2:38082744-38082766 GTGAGGAAGAAAATAGATTTTGG + Intronic
929792837 2:45036414-45036436 ATGAGGAAGAAAATAGATTTTGG + Intergenic
930098777 2:47587248-47587270 GTGAGGAAGAAAATAGATTTTGG + Intergenic
930487099 2:52023875-52023897 GTGAGGAAGAAAATAGATTTTGG + Intergenic
930706466 2:54509390-54509412 GTGAGGAAGAAAATAGATTTTGG + Intronic
930873222 2:56187273-56187295 ATAAAAAAGAAAATGTATTATGG - Intronic
930879870 2:56258792-56258814 ATGAGGAAGAAACTGAAGTACGG + Intronic
930955318 2:57196688-57196710 TTGAGGAAGAAAATAGATTTTGG - Intergenic
931026170 2:58115398-58115420 ATGAGGAAGAAAATAGATTTTGG + Intronic
931042838 2:58317432-58317454 ATGAGGAAGAAAATAGATTTTGG - Intergenic
931167083 2:59759700-59759722 AAGATGAAGAGTATGGGTTAGGG - Intergenic
931237161 2:60421334-60421356 GTGAGGAAGAAAATAGATTTTGG - Intergenic
931572582 2:63684378-63684400 ATCATGAAGAACATTGATGATGG + Intronic
931608716 2:64077159-64077181 ATGAGGAAGAAAATACATTTTGG + Intergenic
931850641 2:66247657-66247679 ATGAGGAAGAAAATAGATTTTGG - Intergenic
931948511 2:67335545-67335567 GTGAGGAAGAAAATAGATTTTGG - Intergenic
932159172 2:69445253-69445275 GTGAGGAAGAAAATAGATTTTGG + Intergenic
932296101 2:70624556-70624578 GTGAGGAAGAAAATAGATTTTGG - Intronic
932367973 2:71164976-71164998 ATGAGGAAGAAAATAGATTTTGG + Intergenic
932853987 2:75215749-75215771 ATGAGGAAGAAAATAGGTTTTGG + Intergenic
932973693 2:76575616-76575638 ATGAGGAAGAAAATAGATTTTGG + Intergenic
933013314 2:77092109-77092131 ATGAGGAAGAAAATAGATTTTGG - Intronic
933079487 2:77968838-77968860 ATGAGGAAGAAAATAGATTTTGG - Intergenic
933161587 2:79029993-79030015 TTGATGAAGAAAATGGACAATGG + Intergenic
933163946 2:79055107-79055129 ATGAGGAAGACAATAGATTTTGG - Intergenic
933179551 2:79213823-79213845 ATGAGGAAGAAAACAGATTTTGG + Intronic
933485118 2:82911611-82911633 ATGATGAAAAAGAATGATTATGG - Intergenic
933552168 2:83790885-83790907 ATGAGGAAGAAAATAGATTTTGG + Intergenic
934153660 2:89174122-89174144 ATCCAGAAAAAAATGGATTATGG - Intergenic
934170814 2:89539762-89539784 TGGATAAAGAAAATGTATTATGG - Intergenic
934213575 2:90007810-90007832 ATCCAGAAAAAAATGGATTATGG + Intergenic
934281119 2:91614080-91614102 TGGATAAAGAAAATGTATTATGG - Intergenic
934680671 2:96281709-96281731 AGGATGAAGAAAAGGTGTTAGGG - Intronic
935387196 2:102512730-102512752 ATGGTGAAGAAGAGGGATTTGGG - Intronic
936794065 2:116186242-116186264 ATGAGGAAGAAAATAGATTTTGG + Intergenic
936828245 2:116607708-116607730 ATGATGAAGAAAAGACAATAAGG - Intergenic
936883553 2:117282466-117282488 ATGAGGAAGAAAATAGGTTTTGG - Intergenic
937440518 2:121911505-121911527 ATGATGAAGAAAATGAAGGATGG + Intergenic
939069503 2:137521908-137521930 ATCATGCAGAACATGGAGTAAGG - Intronic
939307629 2:140429869-140429891 GTGAGGAAGAAAATAGATTTTGG - Intronic
940107606 2:150116545-150116567 GTGAGGAAGAAAATAGATTTTGG - Intergenic
940183987 2:150962413-150962435 GTGAGGAAGAAAATAGATTTTGG - Intergenic
940508558 2:154585211-154585233 GTGAGGAAGAAAATAGATTTTGG + Intergenic
940530414 2:154871046-154871068 GTGAGGAAGAAAATAGATTTTGG - Intergenic
940675589 2:156722047-156722069 ATGAGGAAGAAAATAGATTTTGG + Intergenic
941340620 2:164299581-164299603 ATGAGGAAGAAAATAGATTTTGG - Intergenic
941353609 2:164462847-164462869 ATGAGGAAGAAAATAGATTTTGG - Intergenic
941455914 2:165712101-165712123 GTGAGGAAGAAAATAGATTTTGG + Intergenic
941935635 2:170979406-170979428 GTGAGGAAGAAAATAGATTTTGG + Intergenic
941954591 2:171191570-171191592 TTGAGGAAGAAAATGAATTCAGG - Intronic
942258234 2:174128938-174128960 ATGGTTAAGAATATGGATTTTGG + Intronic
942730035 2:179053529-179053551 GTGAGGAAGAAAATAGATTTTGG + Intergenic
943412701 2:187562464-187562486 GTGAGGAAGAAAATAGATTTTGG + Intronic
943421355 2:187672467-187672489 ATGAGGAAGAAAATAGATTTTGG + Intergenic
943450395 2:188037160-188037182 GTGAGGAAGAAAATAGATTTTGG - Intergenic
943723026 2:191224973-191224995 ATGATTAAGAACATAGATTTTGG + Intergenic
943768675 2:191691626-191691648 ATGAAGAAGAACATGGTTTTGGG + Intronic
943799125 2:192035679-192035701 CTAATAAAGAAAATGGATTTGGG - Intronic
943806863 2:192134146-192134168 GTGAGGAAGAAAATAGATTTTGG - Intronic
943835621 2:192511204-192511226 ATGAGGAAGAAAATAGATTTTGG - Intergenic
943856843 2:192806569-192806591 ATGATTAAGAAAATAAATTTGGG - Intergenic
943951043 2:194132654-194132676 GTGAGGAAGAAAATAGATTTTGG + Intergenic
944251318 2:197582214-197582236 GTGAGGAAGAAAATAGATTTTGG - Intronic
944280698 2:197893124-197893146 CTGATTAAGAAATTTGATTAAGG - Intronic
944297872 2:198087867-198087889 ATGATAATGGAAATGGATTTTGG - Intronic
944373139 2:199010372-199010394 ATGATGAAGCCAATAGATTCTGG + Intergenic
944387673 2:199183104-199183126 ATGAGGAAGAAAATAGATTTTGG - Intergenic
944394360 2:199250662-199250684 ATGAGGAAGAAAATAGATTTTGG - Intergenic
944684627 2:202107155-202107177 ATGAGTAAGAACATGGATTCTGG - Intronic
944875894 2:203963895-203963917 ATGAGGAAGAAAATAGATTTTGG + Intergenic
944878539 2:203987351-203987373 ATGATGAAGATAATTGAAAAAGG - Intergenic
944968015 2:204958467-204958489 ATGATGAAGAACAAGAATAAAGG + Intronic
944994611 2:205279412-205279434 ATAATGAGGAAAATGAATCATGG - Intronic
945152878 2:206808838-206808860 ATGAGGAAGAAAATAGATTTTGG + Intergenic
945173735 2:207021350-207021372 GTGAGGAAGAAAATAGATTTTGG - Intergenic
945361862 2:208902961-208902983 GTGAGGAAGAAAATAGATTTTGG - Intergenic
945376327 2:209081803-209081825 ATGAGGAAGAAAATAGATTTTGG - Intergenic
945394518 2:209302934-209302956 ATGAGGAAGAAAATAGATTTTGG - Intergenic
945683505 2:212940854-212940876 TTGATGAAGAAAAAGAATTGTGG + Intergenic
945938547 2:215926110-215926132 GTGAGGAAGAAAATAGATTTTGG - Intergenic
946129564 2:217595627-217595649 AGGATGAAGAAATTTGAGTAGGG - Intronic
946214811 2:218175993-218176015 ATGAGGAAGAAAATAGATTTTGG + Intergenic
946780791 2:223191602-223191624 GTGAGGAAGAAAATAGATTTTGG + Intronic
946886723 2:224229022-224229044 ATGAGGAAGAAAATAGATTTTGG - Intergenic
946893499 2:224300402-224300424 ATGAGGAAGAAAACAGATTTTGG - Intergenic
946967840 2:225056647-225056669 ATGAACAAGAGAATGGATTTAGG + Intergenic
947842565 2:233217618-233217640 GTGAGGAAGAAAATAGATTTTGG + Intronic
947878913 2:233487864-233487886 AGGATGAAGAAAGTAGAATAAGG + Intronic
947917342 2:233841565-233841587 TTGATGAGGAAAATAGATTTAGG - Exonic
947941784 2:234062701-234062723 ATGTTGAAAGAAATGGATTCTGG + Intronic
948390916 2:237610682-237610704 ATGAGGAAGAAAATAGATTTTGG - Intergenic
948411276 2:237763218-237763240 AGGGTGAAGAAACAGGATTAAGG + Exonic
1168739525 20:175965-175987 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1169757855 20:9062794-9062816 ATAATGAAGAAAATTGCCTAAGG - Intergenic
1170034090 20:11971955-11971977 CTGATTAAGAAAATAGAATATGG - Intergenic
1170165963 20:13360682-13360704 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1170325232 20:15149594-15149616 GTGAGGAAGAAAATAGATTTTGG + Intronic
1170819982 20:19748992-19749014 TTTGTGAAGAAAATGGATTTAGG - Intergenic
1170820476 20:19753136-19753158 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1171234332 20:23512127-23512149 ATGTTTTAGAAAATGCATTAAGG + Intergenic
1172231362 20:33338672-33338694 ATGATGATGATAGTAGATTATGG + Intergenic
1172240309 20:33408556-33408578 ATGATGAAGACTATGGTTTTGGG + Exonic
1172828447 20:37810791-37810813 ATGATGAAGAACATGAGTTTTGG + Intronic
1173102132 20:40097060-40097082 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1173119094 20:40272782-40272804 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1173652328 20:44674469-44674491 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1173673510 20:44814138-44814160 ATGCTTAAGAAAATGAATGAGGG + Intergenic
1173764269 20:45592883-45592905 ATGAACAAGAAAATGGAAGAAGG - Intergenic
1173777991 20:45727523-45727545 AGGAAGAAGCAAATGGAGTAAGG + Intergenic
1174972869 20:55296934-55296956 ATGATCAATTAAATGGAATAAGG - Intergenic
1176685874 21:9848137-9848159 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1177102932 21:16917931-16917953 GTGAGGAAGAAAATGGATTTTGG - Intergenic
1177164874 21:17589074-17589096 ATTATTAAGAAAAAGTATTAGGG - Intronic
1177259075 21:18705591-18705613 ATGTTGATGAAAATGTATTTTGG + Intergenic
1177271605 21:18855775-18855797 ATGATGAAGAAAAAAGACAAAGG + Intergenic
1177318299 21:19489962-19489984 ATGATAAACAGAATGGAATAAGG + Intergenic
1177759098 21:25382601-25382623 ATGATGAAGAAGATTGATGGTGG - Intergenic
1179014998 21:37588706-37588728 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1179263111 21:39776014-39776036 ATGATGAAAAGATTGGATTATGG + Intronic
1179387786 21:40958681-40958703 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1180579305 22:16815037-16815059 ATCATGAGGAAAATGCATTCAGG + Intronic
1182266518 22:29120071-29120093 GTGATGAAGGAAATGGAGGAGGG + Intronic
1182266524 22:29120098-29120120 GTGATGAAGGAAATGGAGGAGGG + Intronic
1182266537 22:29120154-29120176 GTGATGAAGGAAATGGAGGAGGG + Intronic
1182266550 22:29120210-29120232 GTGATGAAGGAAATGGAGGAGGG + Intronic
1182266563 22:29120266-29120288 GTGATGAAGGAAATGGAGGAGGG + Intronic
1182266583 22:29120351-29120373 GTGATGAAGGAAATGGAGGAGGG + Intronic
1182732503 22:32506504-32506526 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1182954403 22:34407789-34407811 ATGATGAAGAAAAGGGAAGTAGG + Intergenic
1182969218 22:34555776-34555798 ATGATAAAGATAATTGAATAAGG - Intergenic
1183249756 22:36722073-36722095 ATGATGAAGAAAGGGGGTTCTGG + Intergenic
1183635372 22:39059061-39059083 GTGAGGAAGAAAATAGATTTTGG + Intronic
1183874581 22:40768120-40768142 ATGATTAAGAGAATGGGTTCTGG - Intergenic
1184079496 22:42209256-42209278 ATGAGGAAGAAATGGGATTCAGG + Intronic
1185145051 22:49128806-49128828 ATGGTGGCGAGAATGGATTAGGG - Intergenic
949161864 3:892646-892668 ATGAGGAAGGAAATAGATTTTGG + Intergenic
949627252 3:5880734-5880756 ATAATGAAGAGAATTAATTATGG - Intergenic
949671384 3:6401411-6401433 ATGAGGAAGAAAATAGATTTTGG - Intergenic
949757323 3:7427389-7427411 ATGAAGAAGAAATTGCATAAAGG + Intronic
949827666 3:8180742-8180764 ATGAGGAAGAAAATAGATTTTGG - Intergenic
950926713 3:16748048-16748070 ATGAGGAAGAAAATAGATTTTGG - Intergenic
951116889 3:18874031-18874053 AAGAGGAAGAAAATGGGGTAGGG + Intergenic
951298591 3:20969489-20969511 ATGAGGAAGAAAATAGATTTTGG + Intergenic
951762528 3:26162143-26162165 GTGAGGAAGAAAATAGATTTTGG + Intergenic
951809559 3:26684460-26684482 ATAATGCACAAAATGGACTAAGG - Intronic
952270183 3:31823284-31823306 CTGATGAACAAATTGAATTAAGG - Intronic
952297156 3:32071684-32071706 GTGAGGAAGAAAATAGATTTTGG - Intronic
952343346 3:32463396-32463418 GTGAGGAAGAAAATAGATTTTGG + Intronic
952402624 3:32976841-32976863 ATGATCAAGAAAATGGATGGTGG + Intergenic
952663237 3:35876304-35876326 ATGAGGAAGAAAACAGATTTTGG + Intergenic
952699384 3:36310004-36310026 AAGAAGAAGAAAATGGATACTGG + Intergenic
952787489 3:37170070-37170092 ATGATGATGATAATGTATTTAGG - Intronic
952894941 3:38072268-38072290 GTGAGGAAGAAAATAGATTTTGG + Intronic
952895831 3:38078254-38078276 ATGAGGAAGAAAATAGATTTTGG + Intronic
952945564 3:38476212-38476234 ATGGTGAGGAAGATGGATTTGGG + Intronic
953076901 3:39579781-39579803 ATGAGGAAGAAAATAGATTTTGG + Intergenic
953177427 3:40564708-40564730 ATGAGGAAGAAAATAGATTTTGG - Intronic
953180967 3:40594971-40594993 AAGATGAAGAAAAAAGACTAAGG - Intergenic
953825481 3:46248287-46248309 ATGAGGAAGAAAATAGATTTTGG + Intronic
953873447 3:46647640-46647662 ATGGTTAAGAGAATGGATTTTGG - Intergenic
954161501 3:48726086-48726108 GTGAGGAAGAAAATAGATTTTGG + Intronic
954969049 3:54636466-54636488 ATGAGGAAGAAAATAGATTTTGG + Intronic
955045588 3:55356977-55356999 ATGGTGAAGAGAAGGGAGTATGG - Intergenic
955253634 3:57307608-57307630 GTGAGGAAGAAAATAGATTTTGG - Intronic
955436839 3:58909496-58909518 ATGAAGAATAAAATTGATTGTGG - Intronic
955473329 3:59310019-59310041 ATGATTAAGAATATGAAGTATGG + Intergenic
955575867 3:60362724-60362746 TTGATGAAGAAAATGAGTCAAGG - Intronic
956233247 3:67040459-67040481 GTGAGGAAGAAAATAGATTTTGG + Intergenic
956548739 3:70436629-70436651 GTGAGGAAGAAAATAGATTTTGG + Intergenic
956709474 3:72026933-72026955 GTGAGGAAGAAAATAGATTTTGG - Intergenic
957295452 3:78327524-78327546 ATGAGGAAGAAAATAGATTTTGG - Intergenic
957317084 3:78585120-78585142 ATGAGGAAGAAAATAGATTTTGG + Intergenic
957904575 3:86539984-86540006 GTGAGGAAGAAAATAGATTCTGG + Intergenic
957946594 3:87070877-87070899 ATGAATAAGAGAATGGATAATGG - Intergenic
957985978 3:87573426-87573448 GTGAGGAAGAAAATAGATTTTGG - Intergenic
958183099 3:90084794-90084816 ATGAGGAAGAAAATAGATTTTGG - Intergenic
958422219 3:93941857-93941879 GTGAGGAAGAAAATAGATTTTGG - Intronic
958482962 3:94667529-94667551 ATGGTGAAGAATATGGAGTCAGG - Intergenic
958517496 3:95136908-95136930 ATGATGAAGAAAGTGGAGAGGGG - Intergenic
958676575 3:97274956-97274978 ATGAGGAAGAAAATAGATTTTGG + Intronic
958751262 3:98195039-98195061 GTGAGGAAGAAAATAGATTTTGG - Intronic
958831499 3:99096000-99096022 GAGAGGAAGAAAATGGATTTTGG + Intergenic
958868429 3:99528333-99528355 ATGAAGAAGAAAAATAATTAAGG - Intergenic
959034676 3:101347015-101347037 AGGAGGAAGAAAATGGAAGAAGG + Intronic
959253803 3:103984124-103984146 ATGATGAAGAAAATACATCAAGG + Intergenic
959288129 3:104441892-104441914 ATGAGGAAGAAAATAGATTTTGG + Intergenic
959536433 3:107491039-107491061 TTTATGAAAAAAATGTATTAAGG - Intergenic
959792582 3:110381192-110381214 ATGATCAAGAAAATGTATGCAGG + Intergenic
959972042 3:112419537-112419559 ATGAGGAAGAAAATAGATTTTGG + Intergenic
960170771 3:114458083-114458105 ATGGTGCTGAAAATGGATGAAGG + Intronic
960282648 3:115795479-115795501 ATGAGGAAGAAATTAGATTTTGG + Intergenic
960309900 3:116107298-116107320 ATGAGGAAGAAAATAGATTTTGG + Intronic
960472460 3:118084073-118084095 ACCATGAAGAAAACGGTTTATGG - Intergenic
961164539 3:124754536-124754558 GTGAGGAAGAAAATAGATTTTGG + Intergenic
961293738 3:125867537-125867559 GTGAGGAAGAAAATAGATTTTGG - Intergenic
961711400 3:128831170-128831192 ATGAGGAAGAAAATAGATTTTGG + Intergenic
961712490 3:128838323-128838345 ATGAGGAAGAAAATAGATTTTGG + Intergenic
961730808 3:128963423-128963445 ATGAGGAAGAAAATAGATTTTGG - Intronic
961881270 3:130062998-130063020 ATGAGGAAGAAAATAGATTTTGG - Intergenic
962205818 3:133433017-133433039 ATGAGGAAGAAAATCGATTTTGG - Intronic
962660891 3:137599420-137599442 GTGAGGAAGAAAATAGATTTTGG - Intergenic
963058884 3:141208892-141208914 GTGAGGAAGAAAATAGATTTTGG - Intergenic
963320021 3:143801396-143801418 GTGAGGAAGAAAATAGATTTTGG - Intronic
963425444 3:145116713-145116735 ATGAGGAAGAAAATAGATTTTGG - Intergenic
963456439 3:145553169-145553191 ATGAGGAAGAAAATAGATTTTGG + Intergenic
963468832 3:145714128-145714150 GTGAGGAAGAAAATAGATTTTGG - Intergenic
963520697 3:146357498-146357520 GTGAGGAAGAAAATAGATTTTGG - Intergenic
963526453 3:146421085-146421107 TAGATGGAGAAAATGTATTAGGG + Intronic
963663571 3:148155382-148155404 ATGAGGAAGAAAATAGATTTTGG - Intergenic
963684548 3:148418082-148418104 ATGAGGAAGAAAATAGATTTTGG - Intergenic
963724794 3:148908018-148908040 ATGATGAAGAAGAGGGGTCATGG + Intergenic
964068117 3:152601180-152601202 GTGAGGAAGAAAATAGATTTTGG - Intergenic
964125230 3:153228665-153228687 GTGAGGAAGAAAATAGATTTTGG + Intergenic
964300001 3:155276949-155276971 GTGAGGAAGAAAATAGATTTAGG + Intergenic
964906302 3:161723863-161723885 ATGAGGAAGAAAATAGATTTTGG + Intergenic
964925687 3:161954073-161954095 CTGATCAAAAAAATGGGTTAAGG - Intergenic
965070577 3:163911476-163911498 GTGAGGAAGAAAATAGATTTTGG - Intergenic
965105018 3:164344109-164344131 ATGAGGAACAAAATAGATTTTGG + Intergenic
965262392 3:166502548-166502570 GTGAGGAAGAAAATAGATTTCGG + Intergenic
965286512 3:166826077-166826099 ATGAGGAAGAAAATAGATTTTGG + Intergenic
965335379 3:167426702-167426724 GTGAGGAAGAAAATAGATTTTGG - Intergenic
965438303 3:168680054-168680076 AAGAGGAAGAATATGGAGTAAGG + Intergenic
965624606 3:170674130-170674152 GTGAGGAAGAAAATAGATTTTGG + Intronic
965626095 3:170685310-170685332 ATGAGGAAGAAAATAGATTTTGG + Intronic
965639754 3:170819563-170819585 GTGAGGAAGAAAATAGATTTTGG + Intronic
965713638 3:171580150-171580172 ATGAGGAAGAAAATAGATTTTGG - Intergenic
965861727 3:173157726-173157748 GTGAGGAAGAAAATAGATTTTGG + Intergenic
966006137 3:175014355-175014377 ATGATTAAGAATAGGGAGTAAGG - Intronic
966067083 3:175831619-175831641 GTGAGGAAGAAAATTGATTCTGG - Intergenic
966104878 3:176323616-176323638 ATGAGGAAGAAAATAGATTTTGG + Intergenic
966232628 3:177667830-177667852 ATGAGGAAGAAAATAGATTTTGG + Intergenic
966279563 3:178211476-178211498 GTGAGGAAGAAAATAGATTTTGG - Intergenic
966371933 3:179259916-179259938 AGGGTGAAGAAAAAGGATTAAGG - Intronic
967005088 3:185376301-185376323 GTGAGGAAGAAAATAGATTTTGG + Intronic
967147425 3:186617874-186617896 ATGTTTAAGAAAATGTATTCTGG + Intronic
967152347 3:186661750-186661772 ATGAGGAAGAAAATCGGTTTTGG - Intronic
967211939 3:187177506-187177528 ATGAGGAAGAAAATAGATTTTGG + Intronic
967243954 3:187468250-187468272 ATGAGGAAGAAAATAGATTTTGG + Intergenic
967496443 3:190148233-190148255 ATGAGGAAGAAAATAGATTTTGG - Intergenic
967561601 3:190923843-190923865 ATGAGGAAGAAAATAGATTTTGG - Intergenic
967624399 3:191668255-191668277 ATGAGGAAGAAAATAGATTTTGG + Intergenic
967643599 3:191897320-191897342 ATGAGGAAGAAAATAGATTTTGG + Intergenic
967657886 3:192073065-192073087 ATGAGGAAGAAAATAGATTTTGG + Intergenic
967740695 3:192999418-192999440 ATGAGGAAGAAAATAGATTTTGG - Intergenic
968023972 3:195422872-195422894 ATCATGAAAAATTTGGATTATGG - Intronic
968331328 3:197873027-197873049 ATGAGGGAGAAAATGCATTCAGG + Intronic
968993603 4:3931104-3931126 GTGAGGAAGAAAATAGATTTTGG - Intergenic
969003566 4:4002028-4002050 GTGAGGAAGAAAATAGATTTTGG + Intergenic
969028965 4:4196117-4196139 TGGATAAAGAAAATGTATTATGG + Intronic
969750441 4:9106498-9106520 GTGAGGAAGAAAATAGATTTTGG - Intergenic
969810358 4:9642795-9642817 GTGAGGAAGAAAATAGATTTTGG - Intergenic
969970170 4:11038634-11038656 ATGATGATGAAAAGGGTTTCTGG - Intergenic
970028969 4:11655510-11655532 GTGAGGAAGAAAATAGATTTTGG + Intergenic
970042297 4:11810010-11810032 ATGAGGAAGAAAATAGATTTTGG - Intergenic
970227200 4:13871631-13871653 ATGATGAAGAGGAGGGATTTCGG - Intergenic
970256193 4:14172502-14172524 ATGAGGAAGAAAATAGATTTTGG + Intergenic
970396710 4:15675227-15675249 AATTTGAAGAAAATGAATTATGG - Intronic
970532958 4:17001397-17001419 ATGAGGAAGAAAATAGATTTTGG - Intergenic
970802960 4:19996779-19996801 ATGTTGAAATAAATGTATTATGG + Intergenic
970853830 4:20632272-20632294 ATGAGGAAGAAAATAGATTTTGG + Intergenic
970939324 4:21613116-21613138 ATAATGAATACACTGGATTATGG - Intronic
971122963 4:23724000-23724022 ATGAGGAAGAAAATAGATTTTGG + Intergenic
971200354 4:24504742-24504764 ATGAGGAAGAAAATAGATTTTGG - Intergenic
971494344 4:27248133-27248155 ATGGTGAAGAAAATGAATAGCGG + Intergenic
971645374 4:29193235-29193257 ATTATGTTGAAAATGGATTATGG - Intergenic
972116699 4:35644524-35644546 ATGATGCAGAAAAAGTATAATGG - Intergenic
972457323 4:39267328-39267350 AAGATGCAGAAAATGGACTCAGG - Intronic
974428181 4:61766276-61766298 ATGAGGAAGAAAATAGATTTTGG + Intronic
974677912 4:65119238-65119260 AAGATGAAAAAAATGGGTAAAGG - Intergenic
974820514 4:67061752-67061774 AAAATGAAAAAATTGGATTAAGG + Intergenic
974869575 4:67623380-67623402 GTGATGAAGAAATAAGATTATGG - Intronic
975864867 4:78715839-78715861 ATGAGGAAGAAAATAGATTTTGG + Intergenic
975933663 4:79555956-79555978 ATGAGGAAGAAAATAGATTTTGG + Intergenic
976130637 4:81880296-81880318 ATGCTGAATAAAAAGGATAATGG + Intronic
976386586 4:84466549-84466571 ATGAAGAAGAATATGGATCCTGG + Intergenic
976511393 4:85913479-85913501 ATGGTGAAGAAAATTTAGTAAGG - Intronic
976696761 4:87925598-87925620 ATGAGGCAGAAAATAGATTTTGG - Intergenic
976719343 4:88154806-88154828 GTGAGGAAGAAAATAGATTTTGG + Intronic
976884338 4:89966740-89966762 ATGAGGAAGAAAATAGATTTTGG + Intergenic
977010529 4:91627813-91627835 ATGAGGAAGAAAATAGATTTTGG - Intergenic
977012709 4:91656599-91656621 GTGAGGAAGAAAATAGATTTTGG + Intergenic
977062281 4:92273480-92273502 ATGAGGAAGAAAATATATTTTGG + Intergenic
977074982 4:92440943-92440965 ATGAGGAAGAAAATAGATTTTGG + Intronic
977155653 4:93569507-93569529 AAAATGCAGAAAATGGATTGGGG - Intronic
977198212 4:94086608-94086630 ATGAGGAAGAAAATAGATTTTGG + Intergenic
977216937 4:94295225-94295247 ATGAGGAAGAAAATAGATTTTGG + Intergenic
977225115 4:94385449-94385471 ATGAGGAAGAAAATAGATTTTGG + Intergenic
977294452 4:95195071-95195093 ATTTTGAAGATAATGGCTTAAGG - Intronic
977591038 4:98827525-98827547 ATGATGATGATGATGGATCATGG - Intergenic
977782184 4:100993549-100993571 GTGAGGAAGAAAATAGATTTTGG + Intergenic
978000898 4:103555739-103555761 ATGAGGAAGAAAATAGATTTTGG + Intergenic
978031741 4:103945078-103945100 GTGAGGAAGAAAATAGATTTTGG - Intergenic
978256709 4:106700966-106700988 ATGATGAAAAGAATGAATGAAGG + Intergenic
978275394 4:106943063-106943085 ATGATGAAGTAAATGGAGGAAGG - Intronic
978438838 4:108712882-108712904 ATGAGGAAGAAAATAGATTTTGG - Intergenic
978457316 4:108908446-108908468 ATGATAAAGAAAAAGAATCAGGG - Intronic
978696949 4:111593235-111593257 ATGATCATTAAAATGGATTGTGG - Intergenic
978926200 4:114248624-114248646 CTGATTAAGAAAAAGAATTAAGG - Intergenic
979054397 4:115977636-115977658 ATGAGGAAGAAAATAGATTTTGG + Intergenic
979146829 4:117255821-117255843 ATGAGGAAGAAAATAGATTTTGG - Intergenic
979247761 4:118528664-118528686 ATGGTGAAGAATATGGACTCTGG + Intergenic
979282762 4:118885861-118885883 ATGATTAAGAATAGGTATTAGGG + Intronic
979296002 4:119032876-119032898 ATAATGAAGTAAATGGGATAAGG + Intronic
979302931 4:119108125-119108147 ATGCTGAAGAAAATAGACAAGGG - Intergenic
979380162 4:119997653-119997675 ATGAGGAAGAAAATAGATTTTGG - Intergenic
979850086 4:125563612-125563634 GTGAGGAAGAAAATAGATTTTGG + Intergenic
979894944 4:126147126-126147148 ATGAAGAAGAAAATAGATTTTGG + Intergenic
980003140 4:127513452-127513474 ATGAGGAAGAAAATAGATTTTGG + Intergenic
980285200 4:130771305-130771327 GTGAGGAAGAAAATAGATTTTGG - Intergenic
980302369 4:131011248-131011270 GTGAGGAAGAAAATAGATTTTGG - Intergenic
980389142 4:132121924-132121946 ATGAGGAAGAAAATAGATTTTGG - Intergenic
980472179 4:133265470-133265492 GTGAGGAAGAAAATAGATTTTGG + Intergenic
980475797 4:133314252-133314274 ATTATCAAAACAATGGATTATGG - Intergenic
980528088 4:134015897-134015919 GTGAGGAAGAAAATAGATTTTGG - Intergenic
980575408 4:134679891-134679913 ATGAGGAAGAAAATAGATTTTGG + Intergenic
980609937 4:135146670-135146692 ATGGTGAAGAAAAAGGCATAAGG + Intergenic
980611555 4:135169281-135169303 ATGAGGAAGAAAATAGATTTTGG + Intergenic
980639495 4:135557380-135557402 TTAATGAAGAAAATGGAGTCAGG - Intergenic
980904163 4:138931596-138931618 ATGAGGAAGAAAATAGATTTTGG - Intergenic
981030513 4:140120680-140120702 ATGAGGAAAAAAAAAGATTAAGG - Intronic
981040466 4:140217226-140217248 ATGAGGAAGAAAATAGATTTTGG - Intergenic
981344243 4:143656971-143656993 ATAATGAAGGAAATTGTTTAGGG + Intronic
981522239 4:145675299-145675321 ATGATGAAGATAAAGAATGAAGG - Intergenic
982083733 4:151814427-151814449 ATGAGGAAGAAAATTGATTTTGG + Intergenic
982180257 4:152743310-152743332 ATGAGGAAGAAAATAGATTTTGG + Intronic
982413944 4:155110264-155110286 GTGAGGAAGAAAATAGATTTTGG + Intergenic
982535663 4:156604015-156604037 ATGAGGAAGAAAATAGATTTTGG - Intergenic
982860964 4:160448497-160448519 ATGATGAAGTAATTGCATTGTGG + Intergenic
982933277 4:161436486-161436508 ATGATGCACAAAATGGATGTTGG - Intronic
983024101 4:162712830-162712852 ATGAGGAAGAAAATAGATTTTGG - Intergenic
983055702 4:163096800-163096822 ATGAGGAAGAAAATAGATTTTGG - Intergenic
983345817 4:166524465-166524487 GTGAGGAAGAAAATAGATTTTGG - Intergenic
983360634 4:166720036-166720058 ATGAGGAAGAAAATAGATTTTGG - Intergenic
983363039 4:166751072-166751094 ATGGAGAAGAAAAGTGATTAAGG - Intronic
983414511 4:167437904-167437926 GTGAGGAAGAAAATAGATTTTGG + Intergenic
983448279 4:167880053-167880075 GTGAGGAAGAAAATAGATTCTGG - Intergenic
983450083 4:167898081-167898103 ATGATAATGAAAATGGTTAATGG - Intergenic
983452561 4:167926622-167926644 GTGAGGAAGAAAATAGATTTTGG - Intergenic
983659796 4:170120182-170120204 ATGAGGAAGAAAATAGATTTTGG - Intergenic
983707922 4:170681430-170681452 GTGAGGAAGAAAATAGATTTTGG - Intergenic
983805574 4:171988010-171988032 ATGAGGAAGAAAATAGATTTTGG + Intronic
983883501 4:172958136-172958158 GTGAGGAAGAAAATAGATTTTGG + Intronic
984098789 4:175463164-175463186 ATGAGGAAGAAAATAGATTTTGG + Intergenic
984165129 4:176296828-176296850 GTGAGGAAGAAAATAGATTTTGG + Intergenic
984226150 4:177037179-177037201 ATGATAAAGATAATTGATTGGGG - Intergenic
984322407 4:178210820-178210842 GTGAGGAAGAAAATAGATTTTGG - Intergenic
984437520 4:179724387-179724409 GTGAGGAAGAAAATAGATTTTGG - Intergenic
984502228 4:180570889-180570911 GTTTTGAAGAAAATGAATTAAGG - Intergenic
984663607 4:182401207-182401229 AGGATGTAGAAAATGTATAAAGG - Intronic
985246320 4:187983117-187983139 ATGAGGAAGTAAATTGACTAGGG + Intergenic
985389636 4:189481350-189481372 ATGAGGAAGCAAATAGATTTTGG + Intergenic
985582567 5:706518-706540 ATGAGGAAGAAAATAGATTTTGG - Intergenic
986193745 5:5519275-5519297 ATGAGGAAGAAAATAGATTTTGG - Intergenic
986368694 5:7059915-7059937 GTGAGGAAGAAAATAGATTTTGG + Intergenic
986389094 5:7267315-7267337 ATGAGGAAGAAAATAGATTTTGG - Intergenic
986429026 5:7663552-7663574 ATGTTGGAGGAAATGAATTAAGG + Intronic
986919364 5:12664516-12664538 ATGAGGAAGAAAATAGATTTTGG + Intergenic
987255644 5:16148040-16148062 ATGAAGAAAAACATGAATTATGG - Intronic
987282215 5:16423451-16423473 ATGAGGAAGAAAATAGATTTTGG - Intergenic
987497908 5:18670834-18670856 ATGAGGAAGAAAATAGATTTTGG + Intergenic
988219964 5:28331999-28332021 ATGAAGAAGAAAAAAGAGTATGG - Intergenic
988252249 5:28774305-28774327 ATTATGAAAAAACTGGATAATGG - Intergenic
988690439 5:33566720-33566742 CAGAAGAAGAAAAAGGATTATGG - Intronic
988967054 5:36429789-36429811 AAGATGAAGAAAATAGCTCAAGG - Intergenic
989026384 5:37073143-37073165 ATGATGAAGGCAATGAAATAGGG + Intergenic
989688649 5:44116335-44116357 GTGAGGAAGAAAATAGATTTTGG + Intergenic
991015896 5:61932102-61932124 AGGATTAAGAAAATGGCTTTGGG - Intergenic
992394887 5:76361086-76361108 ATGAGGAAGAAAATAGATTTTGG - Intergenic
992451737 5:76882149-76882171 GTGAGGAAGAAAATAGATTTTGG + Intronic
992961089 5:81957226-81957248 ATGAGGAAGAAAATAGATTTTGG - Intergenic
993069477 5:83141682-83141704 AAGATGTTGAAAATGTATTAGGG + Intronic
993192933 5:84702210-84702232 ATGAGGAAGAAAATAGATTTTGG - Intergenic
993459565 5:88166282-88166304 ATGTTAGAGAAAATGGATGAAGG - Intergenic
993552025 5:89285042-89285064 ATAAGGGAGAAAATGGATGAGGG - Intergenic
993579781 5:89645893-89645915 AGGATGAAGAAAGTGGATTAAGG + Intergenic
993836912 5:92827691-92827713 ATGAGGAAGAAAATAGATTTTGG - Intergenic
994038963 5:95236217-95236239 ATGATGAAGAAAATGCTTTAAGG + Intronic
994303618 5:98176962-98176984 CTAATGAAGAAAATGCATAAAGG - Intergenic
994532325 5:100986236-100986258 ATGAGGAAGAAAATAGATTTTGG + Intergenic
994557138 5:101318638-101318660 ATGAGGAAGAAAATAGATTTTGG - Intergenic
994672431 5:102778540-102778562 ATGATGGATAAAATGAATCATGG + Intronic
994775898 5:104035341-104035363 GTGAGGAAGAAAATAGATTTTGG - Intergenic
994778732 5:104066178-104066200 GTGAGGAAGAAAATAGATTTTGG + Intergenic
994811988 5:104531533-104531555 ATGATGAAATAAATGCAATAAGG - Intergenic
994967068 5:106686997-106687019 ATTATGTAAAAATTGGATTAAGG - Intergenic
994989769 5:106982097-106982119 ATGAGGAAGAAAATAGATTTTGG - Intergenic
995052787 5:107725201-107725223 ATGCTGAAGATAATAAATTATGG + Intergenic
995077283 5:108001349-108001371 ATGATGAAGCAATTTAATTAGGG - Intronic
995122730 5:108553008-108553030 ATGAGGAAGAAAATAGATTTTGG - Intergenic
995124942 5:108570458-108570480 ATGAGGCAGAAAATAGATTTTGG + Intergenic
995350604 5:111170736-111170758 AGGAAGAAGATAATGGATTTTGG + Intergenic
996202364 5:120692071-120692093 ATGGTGAAGAATATGGATTGTGG - Intergenic
996203038 5:120699569-120699591 ATGAGGAAGAAAATAGATTTTGG + Intergenic
996358400 5:122620847-122620869 ATGAGGAAGAAAATAGATTTTGG + Intergenic
996510121 5:124307520-124307542 GTGAGGAAGAAAATAGATTTTGG - Intergenic
996528269 5:124500780-124500802 ATGAGGAAGAAAATAGATTTTGG - Intergenic
996574764 5:124968589-124968611 GTGAGGAAGAAAATAGATTTTGG + Intergenic
996601675 5:125271445-125271467 ATAATGAAGAATATGGGTTTTGG + Intergenic
996745179 5:126841323-126841345 ATGAGGAAGAAAATAGATTTTGG + Intergenic
996917887 5:128733061-128733083 GTGAGGAAGAAAATAGATTTTGG - Intronic
996929860 5:128872633-128872655 ATGATAAGGAAAATGGCCTAGGG - Intronic
997746620 5:136305042-136305064 ATGAGGAAGAAAACAGATTTTGG - Intronic
997770406 5:136548310-136548332 ATGAAGAAGAAAATAGATTTTGG + Intergenic
997772434 5:136567327-136567349 ATGAGGAAGAAAATAGATTTTGG + Intergenic
998862716 5:146459788-146459810 ATCATGAAGGAAACGGAGTAGGG + Intronic
998908254 5:146930101-146930123 ATTATGAAGAAAATAAATCAGGG + Intronic
998995608 5:147867019-147867041 ATGAGGAAGAAAATAGATTTTGG - Intergenic
998996180 5:147870964-147870986 ATGAGGAAGAAAATAGATTTTGG + Intronic
999500842 5:152145104-152145126 CTGATCAAGATAATGGATCAGGG - Intergenic
999618653 5:153451687-153451709 ATGAGGAAGAAAATAGATTTTGG + Intergenic
999857817 5:155614242-155614264 CCAATGAAGAAAATGTATTAAGG + Intergenic
1000438784 5:161243700-161243722 ATGAGGAAGAAAGTAGATTTTGG - Intergenic
1000440491 5:161257343-161257365 CTGATGAAGAAAATAAGTTATGG + Intergenic
1000594010 5:163193326-163193348 GTGAGGAAAAAAATGGATTCAGG - Intergenic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000885069 5:166740891-166740913 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1000941446 5:167366794-167366816 CTGATGAAAAAAATTGTTTATGG + Intronic
1001466944 5:171975793-171975815 TTGGTGAATAAAAGGGATTAGGG + Intronic
1001855716 5:175008881-175008903 ATGATGAAGAACGTGGACTCTGG - Intergenic
1002502915 5:179658691-179658713 ATGCTGAAGAAAATGCACGATGG - Intergenic
1003100024 6:3169972-3169994 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1003429957 6:6029771-6029793 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1003654745 6:7995902-7995924 ATGATTAAGAATATGGAATTAGG - Intronic
1004283300 6:14298934-14298956 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1004507775 6:16260971-16260993 ATGAGGAAGAAAATAGATTTTGG + Intronic
1004575440 6:16889677-16889699 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1004664596 6:17738239-17738261 ATTATGAAGAATATGAATAAAGG + Intergenic
1004768351 6:18756049-18756071 ATGAGGAAGAAAATAGATTTCGG + Intergenic
1004838146 6:19551590-19551612 ATGATAATGAAAATGGATATGGG + Intergenic
1004850445 6:19693193-19693215 ATGATGATGAAGATGATTTATGG - Intergenic
1005014434 6:21363487-21363509 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1005085393 6:22001229-22001251 ATGATGAAGCAAAGGGACCAAGG + Intergenic
1005570489 6:27140378-27140400 ATGACGATTAAAATAGATTAGGG - Intergenic
1005709935 6:28494270-28494292 CTGATGAAAAAAATGCATGAGGG - Intergenic
1005718158 6:28572249-28572271 TTGATGAAAGAAATGGATTTTGG + Exonic
1007084474 6:39133725-39133747 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1007300710 6:40865876-40865898 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1007373002 6:41439140-41439162 AAGATGAAGAGAATGGATACTGG + Intergenic
1008100033 6:47380289-47380311 ATGGTGGAGAACATGGCTTAGGG + Intergenic
1008152693 6:47974287-47974309 ATGAAGGAGAAAATGGAGTTTGG - Intronic
1008662245 6:53680083-53680105 AAGAGGGAGAAAATGGATTGTGG + Intergenic
1008849989 6:56012802-56012824 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1009359573 6:62795237-62795259 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1009674448 6:66799447-66799469 AAGATGAAGAAAAAAGAGTAAGG - Intergenic
1009737637 6:67698015-67698037 CTGATGAAGAATATTGATAATGG + Intergenic
1009850662 6:69193969-69193991 ATGATGAAGAAGACAGATGATGG - Intronic
1009948406 6:70366553-70366575 ATGATGAAGATAATGCTTTAAGG - Intergenic
1010071465 6:71750323-71750345 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1010431851 6:75786712-75786734 ATGATAAAGAAAATGTGGTAAGG - Intronic
1010715588 6:79225629-79225651 TTGATGAAGACAATGTATCATGG + Intronic
1010784048 6:79979129-79979151 ATGAGGAAGATACTGGATCAGGG - Intergenic
1010829474 6:80512295-80512317 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1010894322 6:81347125-81347147 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1011329794 6:86191484-86191506 ATGAGGAAGCAACTGGTTTATGG + Intergenic
1011367642 6:86600143-86600165 GTGATGAAGAAAATAGATTTTGG + Intergenic
1011770724 6:90672191-90672213 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1012014172 6:93832054-93832076 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1012066321 6:94555920-94555942 ATGAGGAAGAAAACAGATTTTGG + Intergenic
1012264948 6:97130352-97130374 ATGATTAAGAAAATAGTTTCTGG - Intronic
1012316036 6:97783312-97783334 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1012675314 6:102105685-102105707 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1012701676 6:102464660-102464682 ATAATGAATAAAAGGGAGTATGG + Intergenic
1013002550 6:106038505-106038527 ATGAAGAAGAAAAGGGATGCTGG + Intergenic
1013150977 6:107446469-107446491 AAGATGCTGAAAATGGAATAAGG - Intronic
1013407667 6:109857726-109857748 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1013843484 6:114424455-114424477 ATGAGGAAGAAAACAGATTTTGG + Intergenic
1013891928 6:115035610-115035632 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1014115068 6:117661320-117661342 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1014454648 6:121622416-121622438 ATGAGGAAGCAAATAGATTTTGG + Intergenic
1014556065 6:122843559-122843581 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1014614447 6:123584273-123584295 ATGAGGAAGAAAATAGATTTTGG + Intronic
1014646090 6:123974993-123975015 ATGAGGAAATAAATGGATTCAGG - Intronic
1014719118 6:124895771-124895793 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1014793770 6:125703841-125703863 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1014891764 6:126852476-126852498 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1014903708 6:127001379-127001401 ATGATAAGGAAAATAGACTAGGG - Intergenic
1015056924 6:128914055-128914077 TTGAGGAAAAAAATGGATAAGGG - Intronic
1015165461 6:130196259-130196281 ATGAGGAAGAAGATAGATTTTGG - Intronic
1015266965 6:131299182-131299204 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1015269871 6:131327125-131327147 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1015271594 6:131342601-131342623 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1015278378 6:131406545-131406567 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1015287831 6:131506321-131506343 ATGAGGAAGAAAATAGGTTTTGG + Intergenic
1015324050 6:131905417-131905439 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1015472710 6:133623992-133624014 ATGATGAACAAAATTAAGTAGGG + Intergenic
1015523742 6:134156446-134156468 ATGATGAACAAAAAGGAATGTGG - Intergenic
1015586471 6:134781659-134781681 AAGATGAGGAAAATGGATACTGG + Intergenic
1016113925 6:140259430-140259452 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1016204782 6:141456756-141456778 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1016249116 6:142019750-142019772 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1016255531 6:142100754-142100776 TTGATGAGGAAAATTGATAATGG + Intergenic
1016519026 6:144926902-144926924 ATGAGGAAGAAAATAGATTCTGG - Intergenic
1016650068 6:146452402-146452424 ATGAGGATGAAAATAGATTTTGG + Intergenic
1016651593 6:146467733-146467755 ATGATAAAGAAAATGGTTTCTGG + Intergenic
1016751232 6:147632471-147632493 GTGAGGAAGAAAATAGATTTTGG + Intronic
1016853495 6:148643532-148643554 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1017296475 6:152801474-152801496 ATGATTAAAAGAATGGATTCTGG - Intergenic
1017389727 6:153925217-153925239 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1017529502 6:155274876-155274898 ATAAGGAAGAAAATAAATTAAGG - Intronic
1017779122 6:157702634-157702656 ATGAGGAAGAAAATAGATTTTGG + Intronic
1017922598 6:158885170-158885192 GTGAGGAAGAAAATAGATTTTGG + Intronic
1018084268 6:160288554-160288576 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1018135978 6:160778823-160778845 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1018366726 6:163128453-163128475 ATCATGTAGAAAATGAATTTAGG + Intronic
1018495175 6:164340719-164340741 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1018521248 6:164654136-164654158 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1019853919 7:3585582-3585604 ATGAAGAAGGAAATTGATCAGGG + Intronic
1020316271 7:6907510-6907532 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1020322541 7:6950140-6950162 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1020532491 7:9355401-9355423 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1020540882 7:9460317-9460339 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1020826108 7:13031026-13031048 ATAATTAAGAGAATGGATTCTGG + Intergenic
1021172938 7:17417817-17417839 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1021219365 7:17958189-17958211 ATGAAGTAGAAAATGGTTTTCGG - Intergenic
1021308154 7:19057226-19057248 AAGAGGCAGAAAATAGATTAAGG - Intronic
1021363076 7:19741137-19741159 TTTATGAAGAAAATAAATTATGG + Intronic
1021393877 7:20124533-20124555 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1021430072 7:20549172-20549194 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1021977682 7:26026175-26026197 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1022572538 7:31468802-31468824 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1022709328 7:32836304-32836326 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1022854526 7:34302099-34302121 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1023035499 7:36127964-36127986 GTGATTAAGAAAATGTATTTTGG + Intergenic
1023070137 7:36421927-36421949 TTGATGAAGAACATGGAAAAGGG + Exonic
1023698669 7:42872593-42872615 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1024444199 7:49457250-49457272 AAGATAAGGAAAATAGATTATGG - Intergenic
1024856252 7:53783023-53783045 AGAATGAAGAACATGCATTATGG + Intergenic
1025214664 7:57045890-57045912 AAGAATAAGAAAATGGATTGAGG - Intergenic
1025657289 7:63530917-63530939 AAGAATAAGAAAATGGATTGAGG + Intergenic
1026124564 7:67568276-67568298 ATGGTGGGGAAAATGGATTGAGG + Intergenic
1026612287 7:71870717-71870739 CTGAGGAGGAAAATGGATCAAGG + Intronic
1026842751 7:73679603-73679625 GTGAAAAAGAAAAAGGATTAAGG + Intergenic
1027275804 7:76554134-76554156 AGTATGAAGAAAATGCATTCTGG - Intergenic
1027295117 7:76762242-76762264 ATGAAGAAAAAAACGGGTTATGG + Intergenic
1027354624 7:77343257-77343279 GTGAGGAAGAAAATAGATTTTGG - Intronic
1027703976 7:81506155-81506177 ATGAGGAAGAAAATACCTTATGG + Intergenic
1027773489 7:82435703-82435725 AATATGTAGAAGATGGATTAAGG - Intronic
1027852172 7:83463394-83463416 ATGAGGAAGAAAATAGATTTTGG - Intronic
1028123337 7:87082758-87082780 CAGATAGAGAAAATGGATTAAGG - Intergenic
1028580991 7:92409458-92409480 ATGATCAAGATAATGGACAAAGG - Intergenic
1028670726 7:93397663-93397685 ATGAGAAAGAAAATAGATTTTGG - Intergenic
1028690392 7:93643586-93643608 ATGAGGAAGAAAATAGATTTTGG - Intronic
1029013778 7:97292514-97292536 ATTCTGAAGGAACTGGATTATGG - Intergenic
1029500472 7:100926099-100926121 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1030015439 7:105215386-105215408 TTGATGATGAAAATGGAAAATGG + Intronic
1030071788 7:105704183-105704205 GTGATGAGGAAAATGTACTAAGG - Intronic
1030377376 7:108769529-108769551 ATGGAGAAAAAAATGGATCAGGG + Intergenic
1030441434 7:109593808-109593830 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1030445590 7:109644310-109644332 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1030534973 7:110755035-110755057 ATGATACAGGCAATGGATTAAGG + Intronic
1030678578 7:112409864-112409886 ACTATGAAGGAAATGGATCAAGG - Intergenic
1030751283 7:113235566-113235588 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1031004892 7:116459236-116459258 ATGAGGAAGAAAATAGATTTTGG - Intronic
1031069503 7:117145981-117146003 ATGATGATGAAAATGCAGAAAGG - Intronic
1031354970 7:120779120-120779142 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1031364544 7:120887608-120887630 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1031400200 7:121319286-121319308 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1031422193 7:121565591-121565613 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1031458469 7:122013680-122013702 GTGATGAAGAAAGTGGATCAGGG + Exonic
1031525865 7:122820981-122821003 ATGAGGAAGAAAATAGATTTTGG - Intronic
1031584598 7:123518978-123519000 TTGATGAAAAAAATAAATTAGGG - Intronic
1031687030 7:124743416-124743438 CTGATGAGGAAAAAAGATTAGGG + Intergenic
1031727725 7:125260886-125260908 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1031776537 7:125913723-125913745 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1031777592 7:125921514-125921536 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1031801733 7:126255228-126255250 ATGATGAAAAAAATTGAAGAAGG + Intergenic
1032292598 7:130602286-130602308 ATGTCGAAGAAAATGGAGTGAGG - Intronic
1032429271 7:131847790-131847812 CTGCTGTAGAGAATGGATTATGG + Intergenic
1032529068 7:132605150-132605172 TTGATGAAGAGAATGGAGCATGG + Intronic
1033084923 7:138332596-138332618 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1033088809 7:138366466-138366488 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1033156808 7:138963962-138963984 CTGGTGGAGAAAATGGAATATGG + Intronic
1033211725 7:139464858-139464880 GTGAGGAAGAAAATAGATTTTGG - Intronic
1033464786 7:141580595-141580617 GTGAGGAAGAAAATAGATTTTGG + Intronic
1033675725 7:143539203-143539225 ATGAGGAAGAAAATGGATTTTGG + Intergenic
1033696110 7:143790241-143790263 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1033909249 7:146245363-146245385 ATGAGGAAGAAAATAGATTTTGG + Intronic
1034587109 7:152103576-152103598 ATGATGGAGCAACTGGATAAAGG - Intronic
1035108453 7:156461105-156461127 GTGGTGAACACAATGGATTATGG - Intergenic
1035247147 7:157570368-157570390 AGGAGGATGAAAATAGATTACGG - Intronic
1035880411 8:3239987-3240009 GTGAGGAAGAAAATAGATTTTGG + Intronic
1035884447 8:3277174-3277196 ATGATGTTGAAAATTGCTTAGGG + Intronic
1036070670 8:5438412-5438434 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1036281698 8:7406161-7406183 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1036339772 8:7905410-7905432 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1037024333 8:14014401-14014423 ATGAGGAAGAAAGAGGATGAGGG + Intergenic
1037514686 8:19618864-19618886 GTGTGGAAGAAAATGGATGATGG - Intronic
1038522824 8:28247929-28247951 ATGAAGAAGGAATTGGATTCTGG + Intergenic
1039011030 8:33092988-33093010 AGGAAGGAGAAAATGCATTAGGG - Intergenic
1039220971 8:35330367-35330389 CAGATGAAGAAAATGGAGTCTGG - Intronic
1039469550 8:37804781-37804803 ATGTGGAGGAAAACGGATTAGGG - Intronic
1039592749 8:38763801-38763823 ATGTAGAAAAAAATGAATTATGG - Intronic
1039670574 8:39592659-39592681 ATGATGAAGAAAATAGACTCTGG + Intronic
1039859344 8:41443476-41443498 GAGATGGAGAAAATGGATTTTGG + Intergenic
1040648270 8:49423469-49423491 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1040737627 8:50528864-50528886 ATAATAAAGAAAATTAATTAAGG - Intronic
1040861441 8:52003281-52003303 AAGAAGAAGAAAATGGATGTTGG - Intergenic
1041113513 8:54510464-54510486 GTGATGAACAAAATTGATCATGG + Intergenic
1041917274 8:63150095-63150117 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1042007172 8:64194036-64194058 ATGATAAAAAAAATTGGTTATGG + Intergenic
1042453784 8:68976903-68976925 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1042706344 8:71668256-71668278 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1042707593 8:71678644-71678666 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1042785413 8:72540199-72540221 ATGAAGAAAAAAATGCATTAGGG - Intronic
1043167667 8:76924617-76924639 ATGATGAAGGAAAAGAATAAGGG + Intergenic
1043353446 8:79388082-79388104 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1043599109 8:81917390-81917412 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1043717681 8:83507133-83507155 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1043820299 8:84855046-84855068 AGGATGAAGAAACTAGATTGGGG + Intronic
1043837959 8:85066701-85066723 GTGAGGAAGAAAATGGATTTTGG - Intergenic
1044148296 8:88744195-88744217 ATGAGGAAGAGAATAGATTTTGG + Intergenic
1044168475 8:89019028-89019050 CTGATAAACAAAATGGAGTAGGG - Intergenic
1044180456 8:89187270-89187292 ATGATGTAGTAAATATATTAAGG + Intergenic
1044230732 8:89774826-89774848 AGGAAGAAGAAAAAGGATTAAGG + Intronic
1044258400 8:90092193-90092215 ATGAGGAAGAAAATAGATTTTGG + Intronic
1044922215 8:97178804-97178826 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1044925378 8:97204649-97204671 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1045197750 8:99947604-99947626 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1045249666 8:100473011-100473033 ATGATTAAGAACATGAATTTGGG - Intergenic
1045616344 8:103917335-103917357 ATGCTGAAGAAAACGACTTAGGG + Intronic
1045645002 8:104289666-104289688 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1046389407 8:113549387-113549409 AGAATGAAGAAAAGGAATTAAGG - Intergenic
1046406028 8:113773760-113773782 TTGATGAAGAGAATAAATTAGGG + Intergenic
1046440232 8:114245068-114245090 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1046443469 8:114285717-114285739 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1046512300 8:115215958-115215980 ATGAGAAAGAAAATAGATTTTGG - Intergenic
1046559498 8:115818329-115818351 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1046665771 8:117000982-117001004 ATGAAGGGGAAAATGGATTCTGG - Intronic
1046833045 8:118767990-118768012 AAGATGAAGAAAAGGAGTTAAGG - Intergenic
1047699572 8:127435450-127435472 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1047829325 8:128613894-128613916 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1047856625 8:128918352-128918374 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1048168214 8:132082212-132082234 ATGAGGAAGAAAATAGATTTTGG + Intronic
1048221803 8:132549172-132549194 ATGATTAAGAAAAGGTAATAAGG + Intergenic
1048585208 8:135769131-135769153 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1048650914 8:136476334-136476356 ATGATGCAGAATTTGGTTTATGG - Intergenic
1049868546 8:144955865-144955887 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1049929760 9:444995-445017 ATGAAGAAGATAATGGAAGAGGG + Intronic
1050117870 9:2279502-2279524 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1050225328 9:3448411-3448433 CTGATGTAGCAAATGGATTTGGG - Intronic
1050580840 9:7054484-7054506 ATGATCAGGAAGAAGGATTAAGG + Intronic
1050896302 9:10888504-10888526 GTGAGGAAGAAAATAGATTTCGG - Intergenic
1051052852 9:12952075-12952097 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1051924496 9:22307298-22307320 GTGATGAAGAAAATGGATTAAGG + Intergenic
1051953189 9:22660549-22660571 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1052147633 9:25070883-25070905 TGGATGAAGCAAATGAATTATGG + Intergenic
1052420096 9:28232975-28232997 ATAATCAAGAGAATGAATTAAGG + Intronic
1052689075 9:31792147-31792169 ATGATGAAGATGATGAATGATGG - Intergenic
1053058280 9:35007425-35007447 GTGAAGAAGAAAATAGATTTTGG - Intergenic
1053059715 9:35021483-35021505 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1053232518 9:36422635-36422657 GAAATGGAGAAAATGGATTAGGG - Intronic
1053584653 9:39444407-39444429 ATGAAAAAGGAAATGGATAAGGG + Intergenic
1053783437 9:41633460-41633482 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1054106233 9:61003153-61003175 ATGAAAAAGGAAATGGATAAGGG + Intergenic
1054171393 9:61843602-61843624 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1054581664 9:66920815-66920837 ATGAAAAAGGAAATGGATAAGGG - Exonic
1054666141 9:67737210-67737232 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1054807226 9:69406520-69406542 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1055200668 9:73655817-73655839 GTCATGAAGAAAAGGGATAAAGG - Intergenic
1055233290 9:74089391-74089413 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1055795424 9:79970395-79970417 ACGATGAAGGAAAAGCATTAGGG - Intergenic
1055810273 9:80141145-80141167 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1055881957 9:81012740-81012762 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1056061376 9:82887480-82887502 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1056069115 9:82967576-82967598 ATGAAAAAGAAGATGGAGTAAGG - Intergenic
1056324109 9:85462377-85462399 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1056327049 9:85488833-85488855 ATTATGAAGAAATTGAATAAGGG - Intergenic
1056407653 9:86291038-86291060 ATGATGATGAAAACTAATTATGG + Intronic
1056522667 9:87414656-87414678 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1056883197 9:90416308-90416330 ATGAAGAAGAAAATAGATTTTGG - Intergenic
1057235067 9:93351342-93351364 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1057378212 9:94543540-94543562 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1057982307 9:99673890-99673912 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1058025976 9:100142671-100142693 ATGAGGAAGAAAATAGATTTTGG + Intronic
1058866340 9:109165592-109165614 AAGATGGAGAGAATGGATTTGGG - Intronic
1059109829 9:111545511-111545533 ATGTTCTAAAAAATGGATTATGG - Intronic
1059392854 9:114009833-114009855 ATGAGGAAGAAAAAGCATTTGGG - Intronic
1059545952 9:115176603-115176625 ATGAGGAAGAAAATAGATTTTGG + Intronic
1059548785 9:115206538-115206560 ATGATTAAGAAGCTGGATTTTGG + Intronic
1059606483 9:115841180-115841202 ATGAGGAAGAAAATCGATTTTGG + Intergenic
1059804704 9:117786261-117786283 ATGATGAAAAACATTGTTTAAGG + Intergenic
1059863235 9:118487440-118487462 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1059959778 9:119553680-119553702 ATGATGATGACAATGGCTAATGG - Intergenic
1060226429 9:121794059-121794081 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1060264762 9:122104916-122104938 AGGATGATGAAAATAGATCATGG + Intergenic
1060318247 9:122532619-122532641 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1060617904 9:125035754-125035776 ATGATTAATAAAATGAATAATGG + Intronic
1060737618 9:126076394-126076416 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1062132199 9:134903772-134903794 GTGTTGAAGAAAATGGAAGATGG + Intergenic
1185582676 X:1223071-1223093 ATGATGAAGAAAAAGGAAGCGGG - Intergenic
1185858204 X:3555113-3555135 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1185864555 X:3611937-3611959 CTGATGCAGAACATGGATTCTGG + Intronic
1185960468 X:4542462-4542484 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1185962804 X:4564195-4564217 AGGATGAAGAAAATGGCAGAGGG - Intergenic
1185991282 X:4895313-4895335 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1186112631 X:6274165-6274187 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1186322374 X:8443021-8443043 TTGAAGAAGAAAAATGATTATGG - Intergenic
1186784300 X:12943560-12943582 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1187086300 X:16046670-16046692 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1187099747 X:16181161-16181183 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1188141048 X:26551755-26551777 ATGATGAAGAGAAAGAATTAGGG + Intergenic
1188419761 X:29979272-29979294 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1188431286 X:30107285-30107307 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1188463135 X:30450885-30450907 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1188522779 X:31057375-31057397 ATGATGCAGAAAAGCGAGTAAGG + Intergenic
1188531286 X:31144241-31144263 ATGTTGAAGAAGATGGACGAGGG - Intronic
1188552918 X:31381442-31381464 GTGAGGAAGAAAATAGATTTTGG - Intronic
1189049121 X:37625502-37625524 CTGATAAAGATAATGGATTTTGG + Intronic
1189947022 X:46189763-46189785 ATGCTGGAGAAAATGGAGGAGGG - Intergenic
1191761564 X:64653007-64653029 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1191803763 X:65110890-65110912 ATGCTGATGAAAAAGTATTAGGG - Intergenic
1191825836 X:65363840-65363862 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1192302623 X:69921523-69921545 ATGATCAAGTAAATGGATGGTGG - Intronic
1192837341 X:74815043-74815065 GTTATGAAGAATATGTATTAAGG - Intronic
1193390431 X:80920777-80920799 GTCATGAAGAACATGAATTATGG + Intergenic
1193674913 X:84438276-84438298 TTGGGGAAGAAAATGGATAAAGG + Intronic
1193886144 X:86985529-86985551 ATGAGAAAGAAAATAGATTTTGG - Intergenic
1193941717 X:87685625-87685647 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1194072420 X:89343076-89343098 ACTATGAAGAAAATAGAATAAGG + Intergenic
1194171958 X:90597774-90597796 ATTGTGAAGAAAATGGATGGTGG - Intergenic
1194186028 X:90775304-90775326 ATGAGGAAGACAATAGATTTTGG + Intergenic
1194293397 X:92102223-92102245 ATGAGGAAGAAAATAGATTTTGG + Intronic
1194308319 X:92275047-92275069 ATGAGGAAGAAAATAGATTTTGG + Intronic
1194324525 X:92496601-92496623 ATGAGGACGACAATGGATTATGG + Intronic
1194351506 X:92828222-92828244 ATTCTGAAGAAAATAGATTTTGG - Intergenic
1194367327 X:93026659-93026681 ATGAGGAAGAAAATCGATTTTGG - Intergenic
1194410364 X:93550361-93550383 TTGATAAAGAATATGAATTAAGG + Intergenic
1194502758 X:94700800-94700822 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1194660937 X:96627972-96627994 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1194822553 X:98526245-98526267 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1194860575 X:98993462-98993484 ATGAAGATGAAAATGTATTATGG - Intergenic
1194873541 X:99161223-99161245 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1195290897 X:103431314-103431336 GTGAGGAAGAAAATAGATTTGGG + Intergenic
1195326601 X:103763547-103763569 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1195424269 X:104710478-104710500 ATGATAAAGAAAATGCTTAATGG + Intronic
1195471551 X:105235936-105235958 GTGATTAAGAAAATGAATTCTGG - Intronic
1195841711 X:109182150-109182172 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1195908457 X:109867212-109867234 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1196073306 X:111547654-111547676 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1196165766 X:112534347-112534369 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1196220764 X:113110698-113110720 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1196300247 X:114043923-114043945 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1196331045 X:114470493-114470515 ATGAGGAAGAAAACAGATTTTGG - Intergenic
1196341498 X:114603275-114603297 ATGAGGAAGAAAATAGATTTTGG + Intronic
1196347611 X:114683236-114683258 ATGATGAATATAATAGATTGAGG + Intronic
1196497089 X:116334559-116334581 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1196525250 X:116722939-116722961 GTGAGGAAGAAAATAGATTTTGG + Intergenic
1196533328 X:116814469-116814491 ATGAGAAAGAAAATAGATTTTGG + Intergenic
1196572717 X:117282876-117282898 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1196773643 X:119319759-119319781 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1197065130 X:122225767-122225789 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1197351834 X:125390831-125390853 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1197471226 X:126867018-126867040 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1197499973 X:127230532-127230554 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1197922158 X:131606724-131606746 AAGATCGAGAAAATGGATAATGG - Intergenic
1198119179 X:133575114-133575136 AAGATTAAGTAAATGGTTTAAGG - Intronic
1198598669 X:138262535-138262557 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1198599176 X:138266298-138266320 ATGAGGAAGAAAATAGATTTTGG + Intergenic
1198966181 X:142230499-142230521 GTGAGGAAGAAAATAGATTTTGG - Intergenic
1199065196 X:143407771-143407793 ATGAGGAAGAAAATATTTTATGG + Intergenic
1199273705 X:145917043-145917065 ATGAAGAGGAAAATGTATCAAGG + Intergenic
1199377678 X:147132903-147132925 AGGAGGAAGAAAATAGATTTTGG + Intergenic
1199576699 X:149319389-149319411 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1199719754 X:150534451-150534473 ATGACGAAGAAAATATATAATGG + Intergenic
1200532627 Y:4357384-4357406 ATGAGGAAGACAATAGATTTTGG + Intergenic
1200610915 Y:5326769-5326791 ATGAGGAAGAAAATAGATTTTGG + Intronic
1200633268 Y:5615810-5615832 ATGAGGACGACAATGGATTATGG + Intronic
1200659828 Y:5944914-5944936 ATTCTGAAGAAAATAGATTTTGG - Intergenic
1200675537 Y:6142918-6142940 ATGAGGAAGAAAATCAATTTTGG - Intergenic
1200726660 Y:6678822-6678844 ACTATGAAGAAAATAGAATAAGG + Intergenic
1200727812 Y:6694598-6694620 ACTATGAAGAAAATAGAATAAGG + Intergenic
1200887571 Y:8284633-8284655 ATGATTAAGAAGTTGGAATAGGG - Intergenic
1201061474 Y:10050453-10050475 GTGAAGAAGAAAATAGATTTTGG + Intergenic
1201581594 Y:15516110-15516132 ATGAGGAAGAAAATAGATTTTGG - Intergenic
1201885590 Y:18878424-18878446 TTGATGAATTAAATGGAGTAGGG + Intergenic
1201937400 Y:19423075-19423097 GTGAAGAAGAAAATAGATTTTGG - Intergenic
1202076263 Y:21040694-21040716 GTGAGGAAGAAAATAGATTTTGG + Intergenic