ID: 1082792561

View in Genome Browser
Species Human (GRCh38)
Location 11:57356810-57356832
Sequence CCTAAAAATGATGAAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1188
Summary {0: 1, 1: 1, 2: 7, 3: 95, 4: 1084}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082792561_1082792564 12 Left 1082792561 11:57356810-57356832 CCATTTTCTTCATCATTTTTAGG 0: 1
1: 1
2: 7
3: 95
4: 1084
Right 1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG 0: 1
1: 0
2: 0
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082792561 Original CRISPR CCTAAAAATGATGAAGAAAA TGG (reversed) Intronic
900248191 1:1649419-1649441 CCTAGAAATGAAGAAGAATTTGG - Intronic
900326883 1:2112610-2112632 TCAAAAAAGGAAGAAGAAAAAGG + Intronic
900728933 1:4238915-4238937 CCTAAACATGAGCAAGAAAAAGG - Intergenic
900818094 1:4865694-4865716 CCTGAAAGTGATGAGGAGAATGG - Intergenic
901584592 1:10277816-10277838 CCTATTAAAGATGAAGAAAAAGG - Intronic
902318293 1:15640731-15640753 CCCAGAAATAATGAAGGAAAAGG - Intronic
904105602 1:28079641-28079663 CCTAGAAATGGTAAAGAACAGGG + Intronic
904363680 1:29996365-29996387 CCTGAAAGTGATGCAGAGAATGG + Intergenic
904741968 1:32684570-32684592 TTTGAAAATGATGACGAAAAAGG + Exonic
905133778 1:35781717-35781739 CATAAAAATAAAAAAGAAAAAGG - Intergenic
905193227 1:36252465-36252487 TAGACAAATGATGAAGAAAAGGG + Intronic
905840975 1:41177771-41177793 CCTAAAAGTGATGGGGAGAATGG + Intronic
905903637 1:41599527-41599549 CCTAAAAATGAGTAAGAAAAAGG + Intronic
905933167 1:41803924-41803946 CCTAACAATGAAGACAAAAAGGG - Intronic
907148533 1:52259793-52259815 TCTAAAAATAAAAAAGAAAAAGG + Intronic
907177505 1:52538777-52538799 TCTAAAAATGATGATGCAGAAGG + Intronic
907434644 1:54436871-54436893 TCTAAACATGATTAAGCAAATGG - Intergenic
908904007 1:68987007-68987029 CCTGAAAGTGATGAGGAGAATGG + Intergenic
908976929 1:69909880-69909902 CCTGAAAATGATGGGGAGAATGG - Intronic
909195263 1:72612515-72612537 CCTTAAAATGAGGAGGAAAAGGG + Intergenic
909288496 1:73852288-73852310 CCTAAAAATGTTGAAAAGGAGGG + Intergenic
909292264 1:73898743-73898765 CCTAAAAATGAGGAAGTCAGCGG + Intergenic
909521353 1:76572113-76572135 CCAAAAAAAGAGGAAAAAAAAGG - Intronic
909682804 1:78311552-78311574 CCTGAAAGTGATGAGGAGAATGG + Intronic
909727166 1:78850058-78850080 CCTGAAAGTGATGGAGAGAATGG - Intergenic
909957428 1:81797156-81797178 ACAAGTAATGATGAAGAAAATGG + Intronic
910075688 1:83275702-83275724 CCTAGTGTTGATGAAGAAAAGGG - Intergenic
910127127 1:83854989-83855011 CCTAAAAATGGAAAAGACAATGG + Intergenic
910177364 1:84444605-84444627 CCTGAAAGTGATGAGGAGAATGG + Intergenic
910410500 1:86939146-86939168 CCAAACAATAATGATGAAAATGG - Intronic
910614579 1:89183099-89183121 CCTAAACATAAAGAACAAAAGGG + Exonic
910858150 1:91716869-91716891 CTTCAAAGTGATGAAGAATAAGG + Intronic
911472396 1:98334173-98334195 CCTTCAATTGATGAAGCAAATGG + Intergenic
911801660 1:102147049-102147071 AATAAAAATGATGAAAAGAAAGG - Intergenic
911819043 1:102392806-102392828 CCTATGAATGTTGAAGAAATTGG + Intergenic
912081901 1:105947542-105947564 CCTGAAAATGATGGGGAGAATGG + Intergenic
912092279 1:106094318-106094340 CCTATATATTAAGAAGAAAATGG + Intergenic
912223705 1:107707067-107707089 CAAAAAAATTATGATGAAAAAGG + Intronic
912270874 1:108208036-108208058 CCTGAAAGTGATGAAGAGAATGG - Intergenic
912676824 1:111689542-111689564 GAAAAAAATGAGGAAGAAAATGG - Intronic
912893342 1:113558592-113558614 CCTGAAAATGATGGGGAGAATGG + Intronic
912969259 1:114265219-114265241 AATAAAAATGATGAAGAACTTGG - Intergenic
913453127 1:119006431-119006453 CCTTAAACTGGTGAAGCAAACGG + Intergenic
913535978 1:119772854-119772876 GCTCAAAGTGTTGAAGAAAATGG + Intergenic
913557693 1:119984933-119984955 GCCAAAAATGATGAGAAAAATGG + Intronic
914328452 1:146643904-146643926 CCTAAGAATAGTGAAGAAACGGG + Intergenic
914441398 1:147710648-147710670 CCTGAAAGTGATGGAGAGAACGG - Intergenic
915654332 1:157346878-157346900 CCTAAAAGTGATGGAGAGAATGG - Intergenic
915656180 1:157362932-157362954 GATTAAAATGATGAAGTAAAGGG + Intergenic
916468508 1:165096724-165096746 CCTAAAAATGAGTAACAAAATGG + Intergenic
916614697 1:166428066-166428088 CCTGAAAATGATGGGGAGAATGG - Intergenic
916878573 1:168997206-168997228 CCTGAAAATGATGGGGAAAATGG - Intergenic
917399583 1:174632502-174632524 CCTCAAAGTGATGCAGAGAATGG - Intronic
917714415 1:177719809-177719831 CATAATAATAAAGAAGAAAAGGG - Intergenic
917743819 1:177987565-177987587 CCTAAAAGTGATGGGGAGAATGG + Intergenic
918002869 1:180514265-180514287 ACTAAAAATTAAGAAGAAATGGG + Intergenic
918021599 1:180698563-180698585 CACAAAAATGAGAAAGAAAATGG - Intronic
918324618 1:183397445-183397467 CCTAAAAGTGATGGGGAGAATGG + Intronic
918370439 1:183855901-183855923 ACTAAAATTAATGAAGAGAATGG - Intronic
918500151 1:185185785-185185807 TCTTAAAATTTTGAAGAAAAAGG + Intronic
918562960 1:185891920-185891942 CCTAAAAGTGATGGGGAGAATGG - Intronic
918593009 1:186261207-186261229 CCTGAAAATGATGGGGAGAATGG - Intergenic
918786521 1:188770389-188770411 CCTGAAAGAGATGAGGAAAATGG + Intergenic
918923349 1:190745185-190745207 GATTAACATGATGAAGAAAATGG - Intergenic
918986684 1:191638350-191638372 CCAAAAAATAATAAAAAAAATGG - Intergenic
919071931 1:192766821-192766843 TCTAAGGATAATGAAGAAAAGGG - Intergenic
919164262 1:193872409-193872431 CCTGAAAGTGATGAGGAGAATGG + Intergenic
919281697 1:195497527-195497549 GCTGAAAATGTTGAAGAAATTGG + Intergenic
919461496 1:197883139-197883161 CCTGAAAGTGATGAGGAGAATGG - Intergenic
919488243 1:198171158-198171180 CTTAAAAATTACCAAGAAAAGGG + Intronic
919599153 1:199600996-199601018 CCTGAAAATGACGAGGAGAAGGG + Intergenic
920368577 1:205462249-205462271 CTGTAAAATGATAAAGAAAAGGG - Intergenic
920423657 1:205854918-205854940 CCAAAAACTGAAGAAGAATATGG - Intergenic
920827899 1:209438793-209438815 CTGACAAATGATGAAGAAGATGG + Intergenic
920876714 1:209843054-209843076 ACTAAACACAATGAAGAAAAAGG - Intronic
921970648 1:221145531-221145553 GCTGGAAATGATGAAGACAAAGG + Intergenic
922083550 1:222323318-222323340 TCTTAAAAAGTTGAAGAAAAAGG + Intergenic
922112909 1:222579580-222579602 CCTGAAAATCAAGAAGTAAATGG + Intronic
922386922 1:225095639-225095661 CCTAAAAGTTATACAGAAAAAGG + Intronic
922403150 1:225282123-225282145 GCTAAAAATGCTCAAGGAAAAGG + Intronic
922445602 1:225694493-225694515 CCAAAAAATGATGTAGGAGATGG + Intergenic
922509120 1:226148630-226148652 CCTGTAAACAATGAAGAAAATGG + Intronic
922631101 1:227112123-227112145 CTTAATTATGCTGAAGAAAATGG - Intronic
923889300 1:238194466-238194488 CCAACAAAAGATGGAGAAAAGGG - Intergenic
924274531 1:242372162-242372184 AATAATAATGATGAAGAGAAGGG - Intronic
924461950 1:244267378-244267400 TCAAAAAATGAAAAAGAAAAGGG + Intergenic
924843042 1:247734750-247734772 TCATAAAATGATGAAGAAGAAGG + Intergenic
924868371 1:248011558-248011580 CCTGAAAATGATGGGGAGAATGG - Intronic
924899777 1:248385067-248385089 CCAAGAAATTATGGAGAAAAAGG - Intergenic
1062982112 10:1733646-1733668 CCAAAAAATAATAAAGAAAAAGG - Intronic
1063039822 10:2325734-2325756 CATGAAAATCATGAAGAATATGG - Intergenic
1063185593 10:3647963-3647985 CCTAAAAAAGGTTAAGAAGAAGG + Intergenic
1063738075 10:8784563-8784585 CCTAATAATGATGTTGATAATGG + Intergenic
1063790470 10:9439828-9439850 ACAAAAAATAATTAAGAAAAAGG - Intergenic
1063846868 10:10139032-10139054 CTTCAAAATGATCAAGAGAATGG + Intergenic
1064848289 10:19681264-19681286 CCTGAAAGAGATGAGGAAAATGG - Intronic
1065004159 10:21364395-21364417 TCTAAAAATGCAAAAGAAAATGG - Intergenic
1065546228 10:26823958-26823980 TCTAAAAATGAAAAAAAAAAAGG + Intronic
1065621763 10:27588844-27588866 CCTGAAAATGATGGGGAGAATGG + Intergenic
1065682035 10:28245955-28245977 CGAAAAAACAATGAAGAAAAGGG + Intronic
1065842560 10:29715279-29715301 CCTGAAAAATATGAAGAAAATGG - Intronic
1066232483 10:33449809-33449831 CCTAGAAGTGATGAAGATGAGGG - Intergenic
1066233507 10:33461881-33461903 CCTAACTATGAGGATGAAAATGG + Intergenic
1066257491 10:33694906-33694928 CCTGAAAGTGATGGGGAAAATGG - Intergenic
1066983865 10:42446204-42446226 ACTAAGAATGAAAAAGAAAATGG + Intergenic
1067193484 10:44092445-44092467 CCTGAAAGTGATGAGGATAATGG + Intergenic
1067291293 10:44944877-44944899 AGTAAAAAGAATGAAGAAAAAGG - Intergenic
1068210236 10:53911046-53911068 CCTGAAAGTGATGAGGAGAATGG + Intronic
1068285473 10:54928546-54928568 CCTGAAAGAGATGGAGAAAATGG - Intronic
1068886368 10:62101742-62101764 CTTAGAAATCAAGAAGAAAATGG + Intergenic
1069057120 10:63856301-63856323 CCTGAAAATGATGGGGAGAATGG - Intergenic
1069093323 10:64228593-64228615 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1069188873 10:65463034-65463056 CCTAAAAGTGATGGGGAGAATGG - Intergenic
1069340665 10:67404590-67404612 CCTGAAAAAGATGAGGAGAATGG + Intronic
1069368719 10:67721266-67721288 CCTGAAACTGATGGAGAGAATGG - Intergenic
1070007307 10:72436929-72436951 CCTAAAAGTGATGGGGAGAATGG + Intronic
1070016535 10:72538703-72538725 CCAGAAAATGAGGAACAAAATGG + Intronic
1070071364 10:73093223-73093245 ACTAAACATGAGGAAGAGAAAGG + Intronic
1070751979 10:78969237-78969259 CCTATGAATGAGGAAGCAAAGGG - Intergenic
1071144319 10:82549891-82549913 CCAGAAAATAATGCAGAAAATGG - Intronic
1071156492 10:82695309-82695331 TATTAAAATAATGAAGAAAAAGG + Intronic
1071257650 10:83886871-83886893 CAAAAAAATCCTGAAGAAAATGG + Intergenic
1071400829 10:85268891-85268913 CCTCAAAGTGTTGAAGTAAAAGG - Intergenic
1071728061 10:88219544-88219566 CCTGAAAATGAGGTAGAAACCGG - Intergenic
1072394553 10:95025369-95025391 CCTGAAAGTGATGGGGAAAATGG - Intergenic
1072984515 10:100128166-100128188 CCTAAAACTGTTGAATAAATAGG + Intergenic
1073371894 10:102997094-102997116 CCTAAAGAAGGTGAAGAGAAAGG + Intronic
1073658079 10:105439280-105439302 CCAAAAAAAGAGAAAGAAAATGG - Intergenic
1073782016 10:106849195-106849217 CCTGAAAGTGATGCAGAGAATGG - Intronic
1073925094 10:108505911-108505933 CCTGAAAATGATGGGGAGAATGG + Intergenic
1074495906 10:113979909-113979931 CATAAAAATGATCAAGTAGATGG - Intergenic
1074576174 10:114671833-114671855 CCTACAAATCAATAAGAAAAAGG - Intronic
1074644546 10:115431441-115431463 CCAAAACATGAAGAAGAAATTGG - Intronic
1075490914 10:122868315-122868337 CCTGAAAGTGATGAGGAGAATGG + Intronic
1075548418 10:123373688-123373710 CCTAGTAATGATGATGATAATGG - Intergenic
1076022635 10:127086715-127086737 ACGTAAAATGATGACGAAAATGG + Intronic
1076159531 10:128232800-128232822 CCTAAAAGTAATGAAGAACTTGG + Intergenic
1077794684 11:5478893-5478915 CCTGAAAGTGATGAGGAGAATGG + Intronic
1078260834 11:9706900-9706922 GCTAAAAATAAAGAAAAAAAAGG - Intronic
1078283968 11:9932163-9932185 CCTGAAAGTGATGGGGAAAATGG + Intronic
1078607235 11:12787282-12787304 CCCTTAAATGAGGAAGAAAAAGG - Intronic
1078744567 11:14099093-14099115 CCAATAACTGATGAAGAAATTGG - Intronic
1079325476 11:19487461-19487483 TGAAAAAATGATGAAGAACATGG + Intronic
1079362579 11:19781470-19781492 CCTCAAAATGAAGGAGAAAGTGG + Intronic
1079463574 11:20706975-20706997 CCTAAAAATGATGGGGAGAGTGG - Intronic
1079663517 11:23073297-23073319 CCTACAAATGATCAAAAAGAGGG - Intergenic
1079696274 11:23485551-23485573 CCTAAAAGTGATGGGGAGAATGG + Intergenic
1080002790 11:27369698-27369720 GCTAGAAAGGAAGAAGAAAAGGG - Intronic
1080088190 11:28312071-28312093 CTTCAATGTGATGAAGAAAAGGG - Intronic
1080150810 11:29050243-29050265 CCTGAAAGTGATGGGGAAAACGG - Intergenic
1080659019 11:34280922-34280944 CCGCAATATAATGAAGAAAATGG + Intronic
1080705772 11:34691425-34691447 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1080838453 11:35962407-35962429 CCCAAAATTCAGGAAGAAAAAGG - Intronic
1081221746 11:40470917-40470939 CCTGAAAGTGATGAGGAGAATGG + Intronic
1082107367 11:48235282-48235304 CCTGAAAGTGATGGGGAAAATGG - Intergenic
1082138523 11:48578829-48578851 TCTAAAAATGATGAAAGTAAAGG + Intergenic
1082188569 11:49213889-49213911 CCTACAAATAAAAAAGAAAAAGG - Intergenic
1082244076 11:49900678-49900700 TCTACAAATGATGAAAATAAGGG - Intergenic
1082253404 11:50006474-50006496 CCTAAAAGTGATGAGGAGAATGG + Intergenic
1082621496 11:55428775-55428797 TCTAAAAATGATGAAAGTAAGGG + Intergenic
1082782829 11:57300545-57300567 CCTGAAACTGAAGAAGAAGAAGG - Exonic
1082792561 11:57356810-57356832 CCTAAAAATGATGAAGAAAATGG - Intronic
1082860352 11:57849371-57849393 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1082965508 11:58962957-58962979 ACTAAAAATAAAAAAGAAAAGGG - Intronic
1083113668 11:60436804-60436826 CCTAAAAGTGATGGGGAGAATGG + Intronic
1083122956 11:60533554-60533576 CCTAAAAGTGATGGGGAGAATGG + Intronic
1084627744 11:70321613-70321635 CCCAAAAAAGAAAAAGAAAAAGG + Intronic
1085065182 11:73488745-73488767 CCTAATAATGCTCAAGAAAGAGG - Intronic
1085290105 11:75392046-75392068 TCTAAAAAAGAAAAAGAAAAAGG + Intergenic
1085594208 11:77792971-77792993 CATACAAATGAGGAAGAGAAAGG + Intronic
1085853715 11:80151965-80151987 AACAAAAATGATTAAGAAAATGG + Intergenic
1086151914 11:83621194-83621216 TCTAAAAATAATAAACAAAAAGG - Intronic
1086209647 11:84303446-84303468 GATGAAAATGATGAAGAAAAAGG + Intronic
1086235549 11:84625998-84626020 GATAAAAATGATAAAGACAATGG - Intronic
1086475584 11:87169909-87169931 CCTGAAAATGATGGGGAGAATGG - Intronic
1086677953 11:89632808-89632830 CCTACAAATAAAAAAGAAAAAGG + Intergenic
1087427936 11:98013903-98013925 CCTGAAAGTGATGGGGAAAATGG + Intergenic
1088068772 11:105755467-105755489 CCTAAGAAGGAAGGAGAAAATGG - Intronic
1088093394 11:106070025-106070047 ACAAAAAATGCTGAAGAAAATGG + Intronic
1088282935 11:108154236-108154258 CGTAAAAATCAGTAAGAAAAAGG + Intergenic
1088485054 11:110332619-110332641 CCTTAGCATGATGTAGAAAAGGG + Intergenic
1089027998 11:115292038-115292060 CCTAAGAATAATGAAGACTAGGG + Intronic
1089285316 11:117403763-117403785 CCTAAAAGTGATGGGGAGAATGG - Intronic
1090316093 11:125790053-125790075 CCTATACATGATTAAGAACATGG - Intronic
1090928312 11:131272361-131272383 CCTAAAAGTGATGGGGAGAATGG - Intergenic
1091416464 12:290947-290969 CATAAAATTAAGGAAGAAAAGGG + Intronic
1091904671 12:4174836-4174858 CATATTAATGATGAAGAAATAGG + Intergenic
1092114636 12:5990942-5990964 CCCAAAAAAGATGCAGCAAAAGG + Intronic
1092325837 12:7530044-7530066 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1092605742 12:10116695-10116717 CCCAAAAATGATGATGAATTTGG - Intergenic
1092746114 12:11674184-11674206 CCCAAAAATGAAGGCGAAAAAGG - Intronic
1093308781 12:17552236-17552258 ACTAAAAAAATTGAAGAAAAAGG - Intergenic
1093395131 12:18671696-18671718 CAGAAAAATGATGAAGAAAAGGG + Intergenic
1093572578 12:20684228-20684250 ACTATAAATGATGAGGACAATGG - Exonic
1093597566 12:20980350-20980372 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1094233961 12:28141751-28141773 GCTAACAATCATAAAGAAAAGGG + Intronic
1094711442 12:32967125-32967147 CCTGAAAAGAATGAAGAAAAAGG + Intergenic
1094755137 12:33460224-33460246 CCAAAATATGTTGAATAAAAGGG + Intergenic
1094758014 12:33494105-33494127 CCTGGAAGTGATGAGGAAAATGG + Intergenic
1095917981 12:47499097-47499119 CCTGAAAATGATGGAAAGAATGG + Intergenic
1096013171 12:48240679-48240701 TCTAGAATTGATGGAGAAAAGGG - Intergenic
1096208568 12:49744089-49744111 CTTAAAAAAGATGTATAAAATGG + Intronic
1097310491 12:58113893-58113915 CCTGAAAGTGATGCAGAGAATGG - Intergenic
1097324936 12:58265942-58265964 GATAAACATTATGAAGAAAATGG + Intergenic
1097375652 12:58839995-58840017 CCTGAAGGTGATGAAGAGAATGG - Intergenic
1097444796 12:59657295-59657317 TCTACATATGATGATGAAAACGG - Intronic
1097448563 12:59707563-59707585 TCTGAAATTCATGAAGAAAATGG + Intronic
1097508990 12:60512365-60512387 CAAAACAATGATGAAGAAAATGG + Intergenic
1097752447 12:63371015-63371037 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1097767855 12:63545955-63545977 CCTAAAAATGATGTCACAAAGGG - Intergenic
1097777060 12:63659348-63659370 ACTAAAAATAATCAACAAAATGG + Intronic
1098171830 12:67754719-67754741 CCTACCAATGCTGAGGAAAAGGG - Intergenic
1098184119 12:67878450-67878472 CCTAACACTGATGAAGTAATTGG + Intergenic
1098288274 12:68931249-68931271 TTGAAAAATGATGAAGAATATGG + Intronic
1098417773 12:70255256-70255278 GCTAACAATGATAAAGAGAAAGG - Intronic
1098707039 12:73703851-73703873 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1098822040 12:75244374-75244396 CCTAAAAAAGAGCTAGAAAATGG + Intergenic
1099239999 12:80127649-80127671 CCTGAAAATGACGGAGAGAATGG - Intergenic
1099301594 12:80901840-80901862 TCTCAAAGTAATGAAGAAAACGG - Intronic
1099519284 12:83640637-83640659 CACATAAATGAGGAAGAAAATGG - Intergenic
1099524934 12:83707235-83707257 CCTTAAAAAGAGGTAGAAAAAGG + Intergenic
1099697330 12:86039328-86039350 CCTGAAAGTGATGAGGAGAATGG - Intronic
1099833370 12:87874781-87874803 AATAAAAATGAAGAAGCAAAGGG - Intergenic
1099932321 12:89088674-89088696 CATTAAACTGATGAGGAAAATGG + Intergenic
1100215060 12:92439013-92439035 CATAAAAATGAGGGAGAAGAAGG - Intergenic
1100244603 12:92744557-92744579 AATAAAAATAACGAAGAAAAGGG + Intronic
1100381489 12:94065803-94065825 CCTAAAAGTGATGGGGAGAATGG + Intergenic
1100580279 12:95932390-95932412 CCAAAAAATGAAGAAACAAATGG - Intronic
1100750730 12:97695917-97695939 CCTGAAAGTGATGGAGAGAAAGG - Intergenic
1101147504 12:101854955-101854977 CCCAAAAAGGATGCTGAAAAGGG + Intergenic
1101397910 12:104364505-104364527 CTTAAAAATGATGGAGAAGCTGG - Intergenic
1101460121 12:104882928-104882950 CCTGAAAGTGATGAGGAGAATGG - Intronic
1101628482 12:106470059-106470081 CCTGAAAGTGATGAGGAGAATGG - Intronic
1101629146 12:106476476-106476498 CCTGAAAGTGATGAGGAGAATGG - Intronic
1101725191 12:107382970-107382992 CCTTGACATGAAGAAGAAAATGG + Intronic
1102323597 12:111958880-111958902 CCTGAAAGTGATGGGGAAAATGG + Intronic
1103423208 12:120807369-120807391 CCTAACAATTACAAAGAAAACGG + Intronic
1103826463 12:123743073-123743095 CTTAAAAACGGTGAAGAAAGAGG - Intronic
1104315096 12:127691224-127691246 TCTAAACATGATGATGAATAAGG - Intergenic
1104326990 12:127808507-127808529 CCTAAGGATGATGAAGAATATGG + Intergenic
1104526238 12:129525552-129525574 TCTAAAAATGATGAAGAGATGGG + Intronic
1105311725 13:19218175-19218197 CCTGAAAATGATGGGGAGAATGG - Intergenic
1105443968 13:20436801-20436823 CAAAAATAGGATGAAGAAAAAGG - Intronic
1105464763 13:20628416-20628438 CCTGAAAACAATGAGGAAAAGGG - Intronic
1105737223 13:23284214-23284236 CCTGAAAGTGATGGGGAAAATGG - Intronic
1106114420 13:26804703-26804725 CATAAACATGATGAACAACATGG + Intergenic
1106960012 13:34987603-34987625 CCTAAAAGTGATGGGGATAATGG - Intronic
1106983705 13:35320704-35320726 CCTGAAAGTGATGGGGAAAACGG - Intronic
1107067988 13:36237389-36237411 CCTCAAAAAGATAAACAAAATGG + Intronic
1107161723 13:37238216-37238238 CGAAAAAATTATGAAGCAAATGG - Intergenic
1107433172 13:40357685-40357707 CCTGAAAGTGATGCAGAGAATGG + Intergenic
1107704577 13:43087995-43088017 TCTTAAATTGATGAAGAAAGAGG + Intronic
1107725217 13:43292446-43292468 GTGAAAAATGATCAAGAAAAAGG + Intronic
1107874274 13:44776107-44776129 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1108810742 13:54220429-54220451 CCTGAAAGTGATGGAGAAAATGG + Intergenic
1108844741 13:54663702-54663724 ACTCACAATGAAGAAGAAAAAGG + Intergenic
1108892358 13:55277175-55277197 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1109298829 13:60568967-60568989 CTCAAAAAAGAAGAAGAAAAGGG - Intronic
1109358694 13:61267959-61267981 CCTGAAAGTGATGGGGAAAATGG + Intergenic
1109361606 13:61300689-61300711 CCTAAAAGAGATGAAGAGAATGG + Intergenic
1109399020 13:61800211-61800233 CAAAAAAATGATGAACAATATGG + Intergenic
1109519771 13:63494385-63494407 CCTAACAATGGTGAAGTAAAGGG - Intergenic
1109666901 13:65552049-65552071 CCTGAAAATGATGGGGAGAATGG - Intergenic
1109928489 13:69181252-69181274 CATAAAAATAAAGAATAAAATGG + Intergenic
1110261897 13:73494295-73494317 CCTACAACTGATGAAGATGATGG - Intergenic
1110347068 13:74460795-74460817 CATTAAAATGATAAAGAAAAAGG - Intergenic
1110485578 13:76037808-76037830 CCAAAAAATCAGGAATAAAAAGG + Intergenic
1110633481 13:77737362-77737384 CATAGAAATGATGAACTAAATGG - Intronic
1110788619 13:79562087-79562109 CCTGAAAGAGATGAAGAGAATGG + Intergenic
1110890443 13:80691178-80691200 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1111098859 13:83553869-83553891 GTTAAAAATGAAGAAGAAGAAGG - Intergenic
1111362688 13:87195661-87195683 CCCAAAAATAATGAATTAAAAGG - Intergenic
1111406330 13:87811296-87811318 CCTTTAAATGATACAGAAAAGGG - Intergenic
1111480484 13:88818180-88818202 CATAAAAATAAAGAGGAAAATGG + Intergenic
1111498820 13:89089279-89089301 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1111656070 13:91155274-91155296 CTTAGAAATGAGGAAGAATAGGG + Intergenic
1111768589 13:92567272-92567294 CCTACAAATGCTGAAGAACAGGG - Intronic
1112411915 13:99171923-99171945 CCTAAAAGTGATGGGGAGAATGG - Intergenic
1112698991 13:101982500-101982522 CCTAACAGTGATGAATTAAAAGG + Intronic
1112800232 13:103102186-103102208 TTTAAAAATGAAGAAGCAAAAGG - Intergenic
1112857481 13:103788921-103788943 CTTAAAAATTATGTGGAAAATGG - Intergenic
1112954032 13:105037513-105037535 CCTATAAATTATGGGGAAAATGG + Intergenic
1113004571 13:105685105-105685127 CCTAAAACAAAGGAAGAAAAAGG - Intergenic
1113407455 13:110054751-110054773 CCTGAAAAAAAAGAAGAAAAAGG - Intergenic
1114005759 14:18311675-18311697 CATAAATATGATGTAAAAAAGGG - Intergenic
1114153818 14:20076609-20076631 CCAGAAAATGATGAACAAAACGG + Intergenic
1114433958 14:22687519-22687541 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1114490747 14:23100252-23100274 CTCAAAAAAGAAGAAGAAAAAGG + Exonic
1114695340 14:24622330-24622352 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1114924531 14:27378254-27378276 TCTAAAAATGAAGGAGAAATTGG + Intergenic
1115029874 14:28782137-28782159 CTTAAAAATTATAAAGAGAAAGG + Intronic
1115147881 14:30247337-30247359 CCTCAGAATGTGGAAGAAAATGG - Intergenic
1115352304 14:32408374-32408396 CGTAAAAATGATTAAAAGAAAGG + Intronic
1115435978 14:33374070-33374092 TCTAAAAATGATAGAGAAGAAGG + Intronic
1115531084 14:34327790-34327812 CCCAAAAATGTTTAAAAAAAAGG - Intronic
1115657471 14:35457819-35457841 CCTACAAATGATAAAGAGAAAGG - Intergenic
1115772655 14:36682545-36682567 CCTAAAAAGGGTGATGACAAGGG - Intronic
1116127294 14:40803784-40803806 CCTAAAAATGATAAAATTAAAGG - Intergenic
1116188016 14:41623838-41623860 CCAAAAAATGACTATGAAAAGGG - Intronic
1116198185 14:41756374-41756396 CCTAAAAATGACGGGGAGAATGG - Intronic
1116236345 14:42284226-42284248 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1116792867 14:49358110-49358132 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1117188833 14:53271020-53271042 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1117204305 14:53425295-53425317 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1117452284 14:55863145-55863167 CCTGAAAATGATGGGGAGAATGG + Intergenic
1117468479 14:56018626-56018648 CCTGAAAATGATGGGGAGAATGG - Intergenic
1117655621 14:57952820-57952842 CCTAAAAGTGATGGGGAGAATGG + Intronic
1117887776 14:60383156-60383178 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1118498605 14:66334274-66334296 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1118502310 14:66373250-66373272 GCTAAAAATGATGGAGAGATAGG - Intergenic
1118829830 14:69420607-69420629 CCTGAAAGTGATGGAGAGAATGG - Intronic
1118881730 14:69832921-69832943 TCTAAAAATAGGGAAGAAAATGG - Intergenic
1119018314 14:71083458-71083480 CCTGAAAGTGATGCAGAGAATGG - Intronic
1120636485 14:86957981-86958003 TCTCAAAATGAAGAAGCAAAAGG + Intergenic
1121476398 14:94210736-94210758 TGTAAAAATGCTGAAGAATAAGG + Intronic
1121759551 14:96433279-96433301 CCTGAAAGTGATGAGGAGAATGG - Intronic
1121829972 14:97043061-97043083 CCTTAAAATGAAAAAGGAAATGG - Intergenic
1121929530 14:97959945-97959967 CAAAAAGATGAGGAAGAAAAGGG - Intronic
1123438011 15:20269861-20269883 TCTCAAAATAATAAAGAAAAAGG + Intergenic
1123699259 15:22902577-22902599 TTTAAAAATGTTGAGGAAAATGG + Intronic
1124049417 15:26181515-26181537 CCTAAAAAAGAAAAAGAAAATGG + Intergenic
1124058384 15:26263622-26263644 TCTAAGAATGATGTATAAAATGG + Intergenic
1124070594 15:26389305-26389327 CCCAAAAAGCGTGAAGAAAACGG + Intergenic
1124419351 15:29506290-29506312 CCTAAAAGTGATGGGGAGAATGG + Intronic
1124712386 15:32025918-32025940 CCTACAAATAAATAAGAAAAAGG + Intergenic
1124835472 15:33192704-33192726 CCTAAAAAGGATAAAGACAATGG + Intronic
1125573063 15:40735704-40735726 CCTAAAAATGAACATGAGAAAGG + Intergenic
1126401851 15:48280000-48280022 CTTAAAATTAATAAAGAAAAAGG + Intronic
1126760541 15:51966204-51966226 CCTAATGATGATGAAGACGAAGG - Exonic
1126970104 15:54101209-54101231 ACTAAAAATCAAGAAAAAAAAGG - Intronic
1127330753 15:57937347-57937369 ATTAGAAATGATGAAGGAAATGG - Intergenic
1127430369 15:58900852-58900874 CCTAAAAATGATGAATGACCAGG - Intronic
1127523985 15:59773939-59773961 GCTAAAATTGCTAAAGAAAATGG - Intergenic
1127602966 15:60556731-60556753 CCAGAAAATGATGAAGAGAAAGG - Intronic
1128835721 15:70807665-70807687 CCTACATATGAAGGAGAAAAAGG - Intergenic
1130118959 15:81030302-81030324 TCTAAAAAGGATGAAACAAAAGG + Intronic
1130425011 15:83788389-83788411 CATAAAAATGAGGAGGAAAAAGG - Intronic
1130893583 15:88153223-88153245 ACAAAAAATAAAGAAGAAAAGGG - Intronic
1131078169 15:89512070-89512092 CCTACAAATCAATAAGAAAAAGG + Intergenic
1131297301 15:91161321-91161343 ATTAAAAATGTTGAATAAAAAGG + Intronic
1131591025 15:93748234-93748256 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1131842358 15:96450819-96450841 ACTAGACATGATGAAGGAAAAGG - Intergenic
1131991081 15:98092928-98092950 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1132181945 15:99761839-99761861 CCTACAAATGCTGAAGAACAGGG + Intergenic
1132260346 15:100418463-100418485 CCTGAAAGTGATGGGGAAAATGG + Intronic
1132314772 15:100881561-100881583 CCTAAAAATCATAGAGAAAGAGG - Intronic
1134019645 16:10912662-10912684 GGTAAAAATGATGCTGAAAAGGG + Intronic
1134226105 16:12391350-12391372 CTTAAAAATGTAGGAGAAAAGGG - Intronic
1134767479 16:16773606-16773628 CCTAAAAGTGATGGGGAGAATGG - Intergenic
1135346022 16:21689189-21689211 TCTAAAAATGATTTAGAAGAAGG + Intronic
1135650560 16:24202856-24202878 CATAAAAATGAAGGAGAAGAGGG - Intronic
1135670630 16:24372528-24372550 ACTTACAATGATGCAGAAAATGG + Intergenic
1135942424 16:26834207-26834229 CCTAAAAAAGGTGAAGAAGAAGG + Intergenic
1136101084 16:27996775-27996797 TCTAAAAATAAAAAAGAAAAAGG - Intronic
1136986262 16:35108131-35108153 TCTGAAATTGATGGAGAAAAAGG + Intergenic
1138187875 16:54990111-54990133 CCTAAAAAGGAAGAAAATAACGG - Intergenic
1139159413 16:64486195-64486217 CCTAATCATGATGAAGGAATCGG - Intergenic
1139704202 16:68729524-68729546 CTCAAAAAAGATGAACAAAAAGG + Intergenic
1141447550 16:84071488-84071510 CCAAATAATGAGGAAGAAAAGGG + Intronic
1141453780 16:84124728-84124750 ACTAAAAATGAAAGAGAAAAAGG + Exonic
1142936855 17:3341873-3341895 CCTGAAAGTGATGTGGAAAATGG - Intergenic
1143617274 17:8060061-8060083 CCAAAGAATGATGACCAAAATGG + Intergenic
1143846941 17:9779381-9779403 CTCAGAAATGAAGAAGAAAAAGG - Intronic
1144257030 17:13478810-13478832 CCTAAAAATGAGCAAGTAGAAGG + Intergenic
1144360019 17:14483368-14483390 TCTACAAATCATTAAGAAAAGGG + Intergenic
1145387182 17:22422919-22422941 CAGAAAAATGAAGAAGAGAAAGG + Intergenic
1145896441 17:28460706-28460728 CCTACAAATCACTAAGAAAATGG - Intronic
1146203008 17:30876505-30876527 CCTAAAAATAATGAAGAAATAGG + Exonic
1146424704 17:32725724-32725746 GCTAAAACTGATTAAAAAAAAGG + Intronic
1146920823 17:36709725-36709747 ACAAAAAATAATAAAGAAAATGG + Intergenic
1147398535 17:40164200-40164222 CCTAAACCTGATGATGCAAAGGG - Intronic
1147447391 17:40482886-40482908 CCAAAAAAAGAAGAAGAGAAAGG - Intronic
1148234386 17:45958177-45958199 ACTAAAAATGTAGAAGAAAATGG + Intronic
1148510202 17:48162327-48162349 CCTAACAATTATGAATAAATGGG + Intronic
1149162756 17:53714246-53714268 TCTAAAAATGATAAAGTAGAAGG - Intergenic
1149247414 17:54727291-54727313 CCTGAAAAGGAGGAAGAGAAAGG - Intergenic
1149380292 17:56086815-56086837 CTGAAAAATGATTAATAAAAAGG + Intergenic
1149719447 17:58828318-58828340 CTTGAGAATGAAGAAGAAAAGGG - Intronic
1150198648 17:63329295-63329317 CCAAAACATGATGAAAAAATGGG + Intronic
1150902500 17:69297206-69297228 CCTACAAATTCTGAAGAAACTGG + Exonic
1151922163 17:77165073-77165095 CATAAAATAAATGAAGAAAAAGG - Intronic
1153090478 18:1336731-1336753 CCTAAAAGTGATGAGGAGAATGG + Intergenic
1153475146 18:5491001-5491023 CCAAAAGAAGATGAAGAAAATGG - Intronic
1153540489 18:6148921-6148943 CTTAAAAATAATGAAAAAAATGG - Intronic
1153562091 18:6381940-6381962 CCTGAAAGTGATGGAGACAATGG - Intronic
1153955251 18:10090608-10090630 CTTTAACATGAGGAAGAAAAGGG + Intergenic
1154019357 18:10649130-10649152 CCTGAAAGAGATGAAGAGAATGG + Intergenic
1154034113 18:10781949-10781971 AATCAAAATGATGAAGAAAAAGG - Intronic
1154184861 18:12174100-12174122 CCTGAAAGAGATGAAGAGAATGG - Intergenic
1154531669 18:15352206-15352228 CATAAATATGATGTAAAAAAGGG + Intergenic
1155350691 18:24902645-24902667 CCTGAAAATGACGAGGAGAATGG + Intergenic
1155626192 18:27837788-27837810 CTGATAAATGATGAAAAAAAAGG + Intergenic
1155790148 18:29957062-29957084 GATGAAAATGATGATGAAAACGG - Intergenic
1155842265 18:30660212-30660234 CCTTAAAAGGATGAGAAAAATGG + Intergenic
1155897893 18:31352579-31352601 CCTAAAAGTGATGGGGAGAATGG - Intronic
1155960976 18:31994544-31994566 CTGCAAAAAGATGAAGAAAAAGG - Intergenic
1156063045 18:33104157-33104179 TCTTAAAATGATTAAGTAAATGG + Intronic
1156588436 18:38459093-38459115 CATTAAAATAATGAAGAAAAAGG - Intergenic
1156679086 18:39566988-39567010 CCTGAAAGTGATGCAGAGAATGG + Intergenic
1156745457 18:40385727-40385749 ACTAAAAATGAATAATAAAAGGG + Intergenic
1156776163 18:40792008-40792030 TTTAAAAAAGATAAAGAAAAAGG - Intergenic
1156862331 18:41852466-41852488 CCCAAAAATGCTCAAGAGAAAGG + Intergenic
1156942190 18:42781568-42781590 CCTAAAAGTCATGAGGAATATGG - Intronic
1157138229 18:45079679-45079701 CGTGAAGATGATGAAGATAAAGG + Intergenic
1157713017 18:49862990-49863012 CCTGAAAAGGATTAGGAAAAAGG - Intronic
1157845204 18:50997710-50997732 ACTAAGAATAATAAAGAAAAAGG + Intronic
1158171969 18:54610130-54610152 TCTAAGAATGAGGAAGAACAAGG + Intergenic
1158684150 18:59597892-59597914 CCTAGCAATCTTGAAGAAAAGGG + Intronic
1159155260 18:64574062-64574084 CCTAAAAGTGATGGGGAGAATGG + Intergenic
1159196021 18:65115790-65115812 CCAAAAAATGACGACAAAAATGG - Intergenic
1159268404 18:66114991-66115013 CTTAAAAAATGTGAAGAAAAAGG + Intergenic
1159446041 18:68542853-68542875 CCTAGAAAAAATGAAGAGAATGG + Intergenic
1159645641 18:70915375-70915397 CCTAAAAGTGATGGGGAGAATGG - Intergenic
1159863217 18:73673755-73673777 CATAACAATGAAGAAGAAATTGG - Intergenic
1161683341 19:5691432-5691454 CCTCAAATTTATCAAGAAAAGGG + Exonic
1162993914 19:14321296-14321318 CCTAAAAAAAAAAAAGAAAAAGG - Intergenic
1164195235 19:22951053-22951075 CCTAAAAGTGATGGGGAGAATGG + Intergenic
1164246486 19:23434741-23434763 CCTAAAAGTGATGGGGAGAATGG - Intergenic
1164811188 19:31157569-31157591 CAAAAAAATGTTGAAGGAAAAGG + Intergenic
1165209205 19:34219732-34219754 CCTGTAAATGGTGAAGATAAAGG + Exonic
1165270679 19:34704991-34705013 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1165284498 19:34830250-34830272 CCTGAAAATGATGATGATGATGG - Intergenic
1165484249 19:36085852-36085874 GCTAAAAATAAACAAGAAAAAGG - Intronic
1165675884 19:37722901-37722923 ACTAAATATGAGGAAAAAAATGG - Intergenic
1166712550 19:44946518-44946540 TCTAAAAAAGAGAAAGAAAAAGG + Intronic
1168117238 19:54229965-54229987 CCTGTAAATGGTGAAGATAAAGG + Intronic
1168247345 19:55119067-55119089 CATAAAAATCATACAGAAAAGGG + Intergenic
1168496727 19:56858340-56858362 CCTAAGAAGAATGGAGAAAAAGG + Intergenic
925319729 2:2953064-2953086 ATTAAAAATCATGAAGAAAGGGG - Intergenic
925463316 2:4083889-4083911 CCTAGAAATGTGGAAGGAAAAGG - Intergenic
925471852 2:4171257-4171279 GCCAAAAATGATGATGCAAAAGG + Intergenic
925794289 2:7526050-7526072 CCTAAAGATGATCAGGAAAGGGG + Intergenic
926476725 2:13331507-13331529 CCTAACTATGATAAAGAATATGG + Intergenic
927175860 2:20406981-20407003 CCAAAAAAAGAAAAAGAAAAAGG - Intergenic
927831671 2:26356701-26356723 TCTGAACATGATGTAGAAAATGG - Intronic
928655368 2:33445939-33445961 ACGAAAAATGAGGAAGTAAATGG + Intronic
928804888 2:35139205-35139227 CCTGAAAAAGATGGGGAAAATGG - Intergenic
928930923 2:36623273-36623295 CCTAAAAAAAAGGCAGAAAAGGG + Intronic
929257580 2:39829583-39829605 CCTGAAAGTCATGAAGAGAATGG - Intergenic
929728877 2:44464446-44464468 CCAAAATCTGAGGAAGAAAATGG + Intronic
930157928 2:48124631-48124653 CCTAAAAATGTTGGACACAAGGG - Intergenic
930274955 2:49300005-49300027 CCTGAAAGTGATGGAGAGAATGG + Intergenic
930835839 2:55792726-55792748 CCTGAAAGTGATGAGGAGAATGG - Intergenic
931165841 2:59746844-59746866 ACTAAACATTATGAAGAAAAAGG + Intergenic
931546058 2:63388931-63388953 CCTAAAAGTGATGGGGAGAATGG + Intronic
931681669 2:64754294-64754316 CCTAAAAAAGAGGATGAAGATGG + Intergenic
931822607 2:65967678-65967700 CCTGAAAGTGATGGAGAGAATGG - Intergenic
931849871 2:66241865-66241887 CTTAAAAAAGAAGAAGAAAACGG - Intergenic
931956707 2:67435072-67435094 CCTGAAAAGGATGGAGTAAAAGG - Intergenic
932051421 2:68402343-68402365 CCTGAAACTGATGGGGAAAATGG - Intergenic
932328134 2:70877422-70877444 CCTGAAAGTGATGAGGAGAATGG + Intergenic
932660389 2:73646812-73646834 CCTGAAAGTGATGAGGAGAATGG - Intergenic
932662545 2:73669108-73669130 CCTGAAAGTGATGAGGAGAATGG - Intergenic
933217697 2:79649372-79649394 CATAATAATGATGATGAACACGG - Intronic
933479835 2:82841818-82841840 CCTAAAAATGAGGCAGACATAGG + Intergenic
934748788 2:96778174-96778196 CCTAAACATGGTTAAGAAAAAGG - Intronic
934958451 2:98645636-98645658 CATGAAAATGAAGAAGACAATGG + Intronic
935222101 2:101024089-101024111 CCATAAAATGCAGAAGAAAATGG + Intronic
935273789 2:101458820-101458842 CCTGAAAGTGATGGAGAGAATGG - Intronic
935754669 2:106267701-106267723 CCTAAAAACTAAGAATAAAAAGG + Intergenic
935915073 2:107940467-107940489 AATAAAAATGGTGAAGAATAGGG - Intergenic
936513344 2:113166113-113166135 CCTAAGAAGGAAGAGGAAAAGGG - Intronic
936857992 2:116983071-116983093 CCTGAAAGTGATGGAGAGAATGG + Intergenic
936999808 2:118455896-118455918 CCTAAAAGTGATGGGGAGAATGG - Intergenic
937143302 2:119620123-119620145 CCTAAAAGTGATGGGGAGAATGG + Intronic
937745862 2:125414273-125414295 CCTAGACAAGAGGAAGAAAATGG + Intergenic
937838662 2:126501467-126501489 ATTAAAAATTATGAATAAAAGGG + Intergenic
938567955 2:132537652-132537674 CCTGAAAAAGATGGAGAGAATGG - Intronic
939054819 2:137352120-137352142 CCTAAAAATAAAAAAGAGAAGGG + Intronic
939072126 2:137556074-137556096 CGTAAAAGTGATGGAGAGAAAGG + Intronic
939241267 2:139563001-139563023 ACTAAAAATGTAGAAAAAAATGG + Intergenic
939538890 2:143468209-143468231 CTTAAATATGATGAATAAGATGG - Intronic
939786564 2:146520838-146520860 ACTAAAAATGTTTAAAAAAAGGG - Intergenic
939952006 2:148486629-148486651 CCTACAAATCAGGAAGAAAAAGG + Intronic
940114571 2:150193707-150193729 CCTGAAAATGACGGAGAGAATGG + Intergenic
940602753 2:155881740-155881762 CCTGAAAGTGATGAGGAGAATGG + Intergenic
940818197 2:158320004-158320026 CCCAAAAATGAAGAATAAAATGG - Intronic
940925326 2:159357504-159357526 CCTGAAAATGATGGGGAGAATGG + Intronic
941006534 2:160252971-160252993 CCTGAGAATTATGGAGAAAATGG - Intronic
941059971 2:160836071-160836093 CCAAAAAATGATGGTGAAGATGG + Intergenic
941171063 2:162137416-162137438 CCTCAAAAGGTTGGAGAAAAGGG - Intergenic
941418383 2:165250872-165250894 CAGAAAAATGATGAAGAACATGG - Intronic
941510161 2:166397580-166397602 TATAAAAATGGAGAAGAAAATGG + Intergenic
941564171 2:167086552-167086574 CCTGAAAGTGATGAGGAGAATGG - Intronic
941623830 2:167808893-167808915 CCTGAAAGTGATGGAGAGAATGG - Intergenic
941692342 2:168514030-168514052 TCTAAAAATTATGGAGGAAAGGG + Intronic
942257818 2:174123675-174123697 CCTACACATGATTGAGAAAAAGG + Exonic
942426004 2:175861638-175861660 CCTAACAATGAAGAAGAGCAAGG - Intergenic
942520448 2:176797814-176797836 CCTGAAAGTGATGAGGAGAATGG + Intergenic
942576828 2:177372806-177372828 CCTGAAAGTGATGGAGAGAATGG - Intronic
942722391 2:178967135-178967157 CCTGAAAGTGATGAGGAGAATGG + Intronic
943454135 2:188081926-188081948 CCTAAAAATGAAGGTCAAAATGG + Intergenic
943703360 2:191010900-191010922 CCTAAAATTCATTAGGAAAACGG + Intronic
943722614 2:191220838-191220860 CCCAAAAATAATAAAGAAAGAGG + Intergenic
943961682 2:194272526-194272548 CCAAAAACTGATGAAGATAAGGG + Intergenic
943985875 2:194617477-194617499 CATAAAAGCAATGAAGAAAACGG - Intergenic
944228987 2:197374732-197374754 CCTCACAAGGAAGAAGAAAAAGG - Intergenic
944236238 2:197443873-197443895 GGTAAAAATGATGAAGGAGATGG + Intergenic
944307852 2:198197762-198197784 CCTGAAAATGATGAGGAGAATGG + Intronic
945357117 2:208853992-208854014 CCTGAAAATAATGCAAAAAATGG - Intronic
945792058 2:214317561-214317583 GCTAAAAATAATGTAAAAAATGG + Intronic
945870577 2:215221772-215221794 CCTAAAAGTGACGGAGAGAATGG + Intergenic
945880319 2:215318301-215318323 CCTAAAATAAAGGAAGAAAAAGG + Intronic
945922488 2:215769959-215769981 CCTGACAATCATGTAGAAAATGG + Intergenic
946084824 2:217160147-217160169 CCTAGAAACAAAGAAGAAAATGG - Intergenic
946103586 2:217350119-217350141 CCTGAAAGAGATGAAGAGAATGG - Intronic
946382097 2:219355687-219355709 CCTAATAATGATGCCAAAAAAGG + Intergenic
946567702 2:220985449-220985471 AGTAAAGAGGATGAAGAAAATGG + Intergenic
946570700 2:221021117-221021139 TCTGAAAATGATGAACATAAAGG + Intergenic
946580138 2:221119365-221119387 CCTAATAAGGAAGAAGAATATGG - Intergenic
946590582 2:221242994-221243016 CCTGGAAATCATGAAGATAATGG + Intergenic
946684047 2:222249398-222249420 CCTAAGACTGAAGATGAAAATGG - Intronic
947007261 2:225526555-225526577 ACTAAAAATGTTGCTGAAAAAGG - Intronic
947338359 2:229110635-229110657 TCTAAAAATCTTGATGAAAATGG + Intronic
947347154 2:229204322-229204344 ACAAAAAATGATGATGATAATGG + Intronic
947405573 2:229772799-229772821 TTTAAAGCTGATGAAGAAAATGG + Intronic
947738354 2:232471679-232471701 CCAGAAAATAATGAACAAAATGG - Intergenic
947762910 2:232616797-232616819 CCTAAAAATGGTTAAGATGATGG + Intronic
948400250 2:237679402-237679424 CCGTAAAATGATGATGATAATGG + Intronic
1168852585 20:986776-986798 CCTATAAATCAATAAGAAAAAGG + Intronic
1169188392 20:3639645-3639667 CCCCAAAATGATGAAGAAAATGG + Intronic
1169646110 20:7811762-7811784 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1169944127 20:10970770-10970792 TTAAAAACTGATGAAGAAAATGG + Intergenic
1170219484 20:13926733-13926755 CCGAAAAATAATCAATAAAATGG + Intronic
1171050623 20:21854944-21854966 CCTGAAAGTGACGAGGAAAATGG + Intergenic
1171081979 20:22195644-22195666 CCTGAAAGTGACGAGGAAAATGG + Intergenic
1171513243 20:25705304-25705326 CCTGAAAGTGATGGGGAAAATGG - Intergenic
1171944724 20:31366474-31366496 CTTAAAAAAGAAGAAGAAGAAGG + Intergenic
1172820577 20:37729862-37729884 CCTAAAAAAGAAAAATAAAAAGG - Intronic
1173179675 20:40796165-40796187 CCTAAAACTGGTGAGAAAAATGG - Intergenic
1173382256 20:42556427-42556449 CCTTAAAATCATGAAGTAAGTGG + Intronic
1174085118 20:48002163-48002185 CCTAAAAATCAGTAAGAAAAAGG - Intergenic
1174718781 20:52788790-52788812 CCTAAAAATGATGTTGAAAAGGG - Intergenic
1175313621 20:58029186-58029208 TCTTAAAGTGAGGAAGAAAATGG + Intergenic
1176686831 21:9856557-9856579 CCTAAAAATGATGGGAAAAATGG + Intergenic
1176687467 21:9863644-9863666 CCTAAAAAGGATAGAGAAAATGG - Intergenic
1176765688 21:13015962-13015984 CATAAATATGATGTAAAAAAGGG - Intergenic
1176891938 21:14328683-14328705 CCTAAAAGTGATGGGGAGAATGG + Intergenic
1176941272 21:14928478-14928500 CCTGAAAATGATGCAGAGAATGG + Intergenic
1177094133 21:16810451-16810473 CTTAAAAATTATAAAGAAAAGGG - Intergenic
1177142558 21:17373586-17373608 CCTAAAAGTGATGGGGAGAATGG + Intergenic
1177142979 21:17377433-17377455 CCTGAAAGTGATGCAGAGAATGG + Intergenic
1177359129 21:20046375-20046397 CCTGAAAAAGATGAGGAGAATGG + Intergenic
1177943237 21:27436578-27436600 CCTGAAAGTGATGGGGAAAATGG - Intergenic
1178086831 21:29120757-29120779 CCTCAAATTGATGAAAGAAAAGG - Intronic
1178202523 21:30423640-30423662 CCTAAACATGATGGAGGAGAAGG + Intronic
1178284515 21:31314402-31314424 CCTACCTATGAAGAAGAAAAAGG + Intronic
1178352599 21:31883474-31883496 CCTATAAATCAATAAGAAAAAGG - Intronic
1178864279 21:36315276-36315298 CCTGAAAATGATGGGGAGAATGG - Intergenic
1179288432 21:39997632-39997654 TCTAAAGATGGTGTAGAAAAAGG + Intergenic
1179311691 21:40201749-40201771 CTTAATAATTATGTAGAAAAAGG + Intronic
1180008885 21:45036569-45036591 CCTAAACAGGATGAAGGACAGGG + Intergenic
1180110536 21:45646271-45646293 CCTTAAAAAGAAGAATAAAATGG - Intronic
1180322595 22:11336782-11336804 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1180430267 22:15242482-15242504 CATAAATATGATGTAAAAAAGGG - Intergenic
1180512872 22:16110711-16110733 CATAAATATGATGTAAAAAAGGG - Intergenic
1181657128 22:24311954-24311976 CCAAAAAAAGAGGCAGAAAAAGG - Intronic
1181751371 22:24991321-24991343 CCTAAAAATAAGGAAGAAAGGGG - Intronic
1181780222 22:25187032-25187054 CCTAGGAATGAGGAAGAAGAGGG - Intronic
1182160926 22:28120674-28120696 CCTGAAAATGAACAGGAAAAGGG + Intronic
1182174947 22:28275604-28275626 CATAAAAGAGATGAGGAAAAGGG - Intronic
1182204643 22:28611105-28611127 CCTGAAAGTGATGAGGAAAATGG + Intronic
1183885894 22:40881748-40881770 CCTAGAAATGACAAATAAAAGGG - Exonic
949152558 3:787996-788018 CAAACAAATGATGATGAAAATGG + Intergenic
949175897 3:1062393-1062415 CCTGAAAATGATCAGGAGAATGG - Intergenic
949191998 3:1261329-1261351 CCAAAAACTGATGAAGAATAAGG + Intronic
949244139 3:1905644-1905666 CAAAAAAATGATGAACACAAAGG + Intergenic
950130678 3:10544037-10544059 CTTAAAAATTATGAAGAACAGGG - Intronic
950597293 3:13995888-13995910 CCTGAAAGTGATGAGGAGAATGG - Intronic
950992186 3:17450767-17450789 CCTGAAAGTGATGGAGAGAATGG + Intronic
951184618 3:19698504-19698526 CATAAAATAGATGAAGAAAAAGG + Intergenic
951311059 3:21126396-21126418 CCTGAAAATGACGGGGAAAATGG + Intergenic
951327019 3:21314538-21314560 TTTAAAAAAGATGAACAAAATGG - Intergenic
951414978 3:22413165-22413187 CCTGAAAGTGATGGAGAGAATGG - Intergenic
951539225 3:23766408-23766430 TCTCAAAAAGAAGAAGAAAAAGG - Intergenic
951676281 3:25245927-25245949 ACTGAAAGTGATGAGGAAAATGG - Intronic
951697297 3:25458902-25458924 GCTCAAAATGAGGAAGAAAAAGG + Intronic
951893955 3:27593327-27593349 CATAATAATGTTGAAAAAAAAGG - Intergenic
951939377 3:28060631-28060653 CCTGAAAGTGATGGAGAGAATGG + Intergenic
952249047 3:31631463-31631485 CTTAAAAGAGAGGAAGAAAAAGG - Intronic
952286462 3:31974078-31974100 CGTAAAAGTCAAGAAGAAAAAGG + Intronic
952316235 3:32235075-32235097 TGTAAAAATGGAGAAGAAAATGG - Intergenic
952361691 3:32636582-32636604 GCAAAAATTGAAGAAGAAAAGGG - Intergenic
952547086 3:34432347-34432369 CCTGAAAGTGACGAGGAAAATGG - Intergenic
952613779 3:35244587-35244609 TCTAAAAATGAGTAAGAAAGTGG + Intergenic
953124306 3:40076863-40076885 ACAGAAAATTATGAAGAAAAAGG - Intronic
953316026 3:41926880-41926902 CCTGAAAGTGATGGAGAGAATGG + Intronic
953513496 3:43567215-43567237 CCTAAAAGTGATGGGGAGAATGG + Intronic
953971229 3:47348792-47348814 CGTAAAAAGGAGGAAGACAAGGG - Intergenic
954057018 3:48035284-48035306 ATTAAAATTGAAGAAGAAAAAGG + Intronic
955300279 3:57771529-57771551 TCTAAAAAAAAAGAAGAAAAAGG - Intronic
955373665 3:58375520-58375542 CCAAACAATGTTGAACAAAACGG - Intronic
955630167 3:60965040-60965062 CCTGAAAGTGATGAGGAGAATGG - Intronic
955637389 3:61044515-61044537 CCTGAAAGTGATGAGGAGAATGG + Intronic
955843615 3:63137664-63137686 CCTGAAAGTGATGAGGAGAATGG + Intergenic
955854384 3:63257102-63257124 CCTGAAAGTGATGAGGAGAATGG + Intronic
956032596 3:65055248-65055270 CCTGAAAATGATGGGGAGAATGG + Intergenic
956342380 3:68240125-68240147 TTTAGAAATGATGAAGAGAATGG + Intronic
956934768 3:74088157-74088179 AGTAGAAATGAAGAAGAAAAAGG - Intergenic
957185752 3:76939161-76939183 GATAAAAATGAAGAAGAGAAAGG + Intronic
957256460 3:77843983-77844005 CCTGAAAGTGATGGGGAAAATGG - Intergenic
957667223 3:83248324-83248346 TCAAAAAATGATAAATAAAAAGG - Intergenic
957716660 3:83936893-83936915 CCAGAAAATGATGAAGAAAATGG + Intergenic
957749809 3:84399948-84399970 GCTCAAAATGAAGCAGAAAAAGG + Intergenic
957917719 3:86707946-86707968 CCTGAAATTGATGAGGAGAATGG - Intergenic
957948687 3:87096854-87096876 CCTGAAAGTGACGAAGAGAATGG - Intergenic
958512264 3:95064412-95064434 CCTGAAAGTGATGAGGAGAATGG - Intergenic
958522088 3:95203413-95203435 CCTGAAAAAGATGGAGAGAATGG - Intergenic
958863637 3:99473894-99473916 ACTAAAAATCAATAAGAAAAAGG - Intergenic
958997227 3:100918513-100918535 CTTAAGAATGATAAAGCAAATGG + Intronic
959478385 3:106839592-106839614 CCTAAAAAGGATGATCAAATAGG + Intergenic
959747065 3:109787998-109788020 CCTACAAAAGATCAAGAATATGG + Intergenic
960065530 3:113368122-113368144 CCTGAAAGTGATGGGGAAAATGG + Intronic
960308066 3:116086829-116086851 CCTAAACAAGAAGAAGATAATGG - Intronic
960883674 3:122372519-122372541 CTTAAAAAGCATCAAGAAAATGG + Intronic
960912138 3:122660350-122660372 ACTAAAAATGATGAATATGAAGG + Intergenic
961162242 3:124738281-124738303 GCTTAAACTGAAGAAGAAAAAGG + Intronic
961920177 3:130417320-130417342 CATGAAAATCAGGAAGAAAATGG - Intronic
962125000 3:132607657-132607679 CCTGAAAATGATGGGGAGAATGG + Intronic
962460322 3:135605746-135605768 CCTGAAAATGATGGGGAGAATGG + Intergenic
962538524 3:136354214-136354236 CCAAAAAAGGAGGAAGGAAATGG + Intronic
962607024 3:137041009-137041031 ACTAAAAATGTTAAGGAAAAAGG + Intergenic
962824294 3:139085529-139085551 CCTACAAATTAAAAAGAAAAAGG - Intronic
962918055 3:139925754-139925776 CCAAAAAATCAAGAAGAAGAGGG - Intergenic
963551268 3:146727004-146727026 CCTGAAAGTGATGGGGAAAATGG + Intergenic
963847447 3:150173504-150173526 CCAAAAAATAAAGAATAAAATGG - Intergenic
963979362 3:151519395-151519417 CACAAAAATGATGAGGAAAGAGG - Intergenic
964049319 3:152371909-152371931 CCTGAAAATGATGGGGAGAATGG - Intronic
964264501 3:154878899-154878921 CCTGAAAATGATGGGGAGAATGG - Intergenic
964566839 3:158065929-158065951 CCTGAAAGTGATGGGGAAAATGG + Intergenic
965317022 3:167204999-167205021 GAAAAAAATGATGAAGAAATAGG + Intergenic
965334109 3:167414624-167414646 CTTAAAAATTTTGAAGAAAAGGG + Intergenic
965560650 3:170059240-170059262 ACTAAAAATAATGAAAACAAAGG + Intronic
965600190 3:170446766-170446788 TCTAAAACTGAAGAAAAAAAAGG - Intronic
966006138 3:175014362-175014384 GTTAAAAATGATTAAGAATAGGG - Intronic
966876040 3:184322239-184322261 CCTAAAAAGGGTGATGCAAAGGG + Intronic
967191233 3:186986567-186986589 CCGAAAAGTGCTGAAGAATATGG - Intronic
967356229 3:188574920-188574942 CGTAACAGTGATGAAAAAAAGGG - Intronic
967569761 3:191015148-191015170 CCTGAAAGTGATGAGGAGAATGG - Intergenic
968263817 3:197346762-197346784 CCTAAAAATCAATAAGAAAAAGG - Intergenic
969963044 4:10965438-10965460 TTTAAAGATGATGAAGAAATTGG - Intergenic
970000534 4:11361153-11361175 CCTAATGATGAGGAAGAAGATGG + Intergenic
970259704 4:14211709-14211731 CCTGAAAGTGATGGAGAGAATGG - Intergenic
970270598 4:14343154-14343176 CTTAGAGGTGATGAAGAAAAGGG - Intergenic
970304834 4:14720263-14720285 CCTGAAAATGATGGGGAGAATGG + Intergenic
970685398 4:18560963-18560985 CCTGAAAATGATGGGGAGAATGG + Intergenic
970714482 4:18905708-18905730 CCTGAAAGTGATGGAGAGAATGG + Intergenic
971032390 4:22653832-22653854 CTTAAAAATGAAAAAGAAACTGG - Intergenic
971550147 4:27944259-27944281 CACAAAAATAATGAAGAAAATGG + Intergenic
971656878 4:29359045-29359067 CCCGAATTTGATGAAGAAAATGG - Intergenic
972090261 4:35272771-35272793 CATAATAATAATGAAGTAAATGG + Intergenic
972742824 4:41905220-41905242 CCTGAAAATGATGGGGAGAATGG - Intergenic
972984609 4:44748598-44748620 CCTGAAAGTGATGGGGAAAATGG - Intergenic
973103400 4:46300409-46300431 CCTAAAATTGCAGAATAAAAAGG - Intronic
973137612 4:46727221-46727243 CCTGAAAGTGATGAGGAGAATGG - Intergenic
973207846 4:47580376-47580398 CCTAGAAATGAAGCAGATAACGG - Exonic
973546619 4:51989017-51989039 CCTGAAAATGATGGGGAGAATGG - Intergenic
974092861 4:57330491-57330513 ATTAATAATGATGAAGAAAAAGG - Intergenic
974127659 4:57715633-57715655 CCTGAAAGTGATGGAGAGAATGG + Intergenic
974132078 4:57769151-57769173 CCTGAAAATGATGGGGAGAATGG + Intergenic
974419665 4:61657155-61657177 TATAAAAATGATGGGGAAAATGG - Intronic
974677914 4:65119245-65119267 CACAAAAAAGATGAAAAAAATGG - Intergenic
974943980 4:68504474-68504496 CCTGAAAGTGATGGAGAGAATGG + Intergenic
974946467 4:68535050-68535072 CCCAAAAGTGATGGGGAAAATGG - Intergenic
975034385 4:69662335-69662357 CCTGAAAGTGATGGGGAAAATGG + Intergenic
975227674 4:71892910-71892932 CCTGAAAATGATGGGGAGAATGG + Intergenic
975366113 4:73530068-73530090 TCACAAAATGAGGAAGAAAAAGG - Intergenic
975486118 4:74935250-74935272 GCTGAAAATGATGAAGCTAATGG + Intronic
975500412 4:75078838-75078860 CCTGAAAGTGATGGAGAGAATGG - Intergenic
975559626 4:75696940-75696962 TCTGAATATGTTGAAGAAAAGGG - Intronic
975594546 4:76036839-76036861 CCTCAAATTCATCAAGAAAAGGG - Intronic
975753458 4:77548944-77548966 CCTGAAAGTGATGAGGAGAATGG - Intronic
975843887 4:78505335-78505357 CCTGAAAATGATGGGGAAAATGG - Intronic
976318047 4:83680712-83680734 CTTACAAAGCATGAAGAAAAAGG + Intergenic
976374393 4:84327501-84327523 CCAAAAAACTATGCAGAAAAAGG - Intergenic
976521198 4:86029214-86029236 ACTAAAAATGGTGTAGTAAAAGG - Exonic
976524799 4:86075003-86075025 CCTGAAAGTGATGAGGAGAATGG - Intronic
976792934 4:88900166-88900188 CCTGAAAGAGATGAGGAAAATGG + Intronic
976950561 4:90824786-90824808 CCTAAATATGAAAAAGAAAGAGG - Intronic
977219664 4:94324367-94324389 CCTAAACATGATGGGGAGAATGG - Intronic
977516075 4:98022627-98022649 CCTGAAAGTGATGGGGAAAATGG - Intronic
977539145 4:98294559-98294581 GCTCAAAATGGTAAAGAAAAAGG + Intronic
977623182 4:99160944-99160966 CCCAAAATTGAGGATGAAAAAGG - Intergenic
977657123 4:99535345-99535367 CCTAAAAGAGATGAGGAGAATGG - Intronic
977693444 4:99942124-99942146 GCAAAAAATTAGGAAGAAAAAGG + Intronic
977806222 4:101300947-101300969 CCAAAAAATAATAATGAAAAGGG + Intronic
977821485 4:101477056-101477078 AATAAAACTGAGGAAGAAAATGG - Intronic
977946608 4:102920943-102920965 CCTGAAAGTGATGAGGAGAATGG + Intronic
978022468 4:103831056-103831078 CATGAAAATGATGGAGAGAATGG - Intergenic
978059466 4:104319108-104319130 CCTTTATATGATGAGGAAAAAGG - Intergenic
978494153 4:109341090-109341112 CCTGAAAGTGATGGAGAGAATGG + Intergenic
978601247 4:110430777-110430799 CCTGAAAGTGATGAGGAGAATGG - Intronic
978880632 4:113698180-113698202 ACTAAAAATGAAAAATAAAATGG + Intronic
979076411 4:116276191-116276213 CCTAAAAGAGATGGAGAAAATGG + Intergenic
979145986 4:117249536-117249558 AGTCAAAATGATAAAGAAAAAGG + Intergenic
979310654 4:119199194-119199216 CCTGAAAGTGATGGGGAAAATGG + Intronic
979581527 4:122366334-122366356 CCTAAAAGTGATGGGGAGAATGG + Intergenic
979708068 4:123745199-123745221 CCTGAAAAGGAACAAGAAAAAGG + Intergenic
979957034 4:126966954-126966976 ACTCAAAATAATGAAAAAAAAGG + Intergenic
980033838 4:127861056-127861078 CCTGAAAGTGATGGAGAGAATGG + Intergenic
980151510 4:129054358-129054380 CCTGAAAGTGACGGAGAAAATGG - Intronic
980350871 4:131681759-131681781 CCTAAAAAGGATAGAGAAAATGG - Intergenic
980503839 4:133689796-133689818 CCTGAAAGTGATGAGGAGAATGG - Intergenic
981060127 4:140414732-140414754 CCTAAAAGTGATGGGGAGAATGG + Intronic
981365932 4:143903126-143903148 CCGAAAACTGCTTAAGAAAAGGG - Intronic
981376038 4:144016938-144016960 CCGAAAACTGCTTAAGAAAAGGG - Intronic
981642795 4:146964884-146964906 GCAAAAAAAGGTGAAGAAAAAGG + Intergenic
981916455 4:150039209-150039231 CCTGAAAGTCATGAAGAAATAGG + Intergenic
982129403 4:152213985-152214007 CATAGAGATAATGAAGAAAATGG + Intergenic
982511539 4:156289198-156289220 CCTGAAAGTGATGGAGAGAATGG - Intergenic
982643154 4:157987875-157987897 TCCAAAAAGGATGAAGAATAGGG - Intergenic
982678345 4:158401074-158401096 CCTAAAAATGATAAAGACTTCGG + Intronic
982935674 4:161472275-161472297 CTTTAAAAAGATCAAGAAAATGG - Intronic
983158351 4:164380107-164380129 CATAAAAATTATGAAGTAAGTGG - Intronic
983456460 4:167970610-167970632 CCAAAAAATGAATAATAAAATGG + Intergenic
983554230 4:169045762-169045784 CCTAAAGATGCTGAGAAAAATGG - Intergenic
983603338 4:169555330-169555352 CTTTGAAGTGATGAAGAAAAGGG + Intronic
983778006 4:171632594-171632616 TCTAAAAATAATAAAGAAAAAGG - Intergenic
983934322 4:173490332-173490354 CCTAAAAGTGAAAAAGAAACTGG - Intergenic
983948956 4:173617825-173617847 CCTAAAAGTGATGGGGAGAATGG - Intergenic
984008919 4:174347215-174347237 CCTGAAAGTGATGAGGAGAATGG - Intergenic
984015082 4:174416505-174416527 CCTGAAAGTGATGGAGAGAATGG - Intergenic
984194386 4:176641035-176641057 ACTAAGAATGAAGATGAAAAGGG - Intergenic
984494639 4:180480840-180480862 CATAAAAATGCTGATAAAAAAGG + Intergenic
984657272 4:182331632-182331654 ACTTAAAATGGTAAAGAAAATGG + Intronic
984658042 4:182341009-182341031 TCCATATATGATGAAGAAAAAGG + Intronic
984819732 4:183870969-183870991 CCTAGAAATCATGAAGATACTGG + Intronic
985230478 4:187810760-187810782 CCTAAAAAAGAAGATTAAAAAGG - Intergenic
985853339 5:2405201-2405223 GCTAAAAGTGAAAAAGAAAATGG + Intergenic
986385799 5:7232115-7232137 CCTGAAAGTGATGAGGATAATGG + Intergenic
986613316 5:9591533-9591555 ACTACAAATCATCAAGAAAAAGG + Intergenic
986677685 5:10201271-10201293 CCTAAAAAAAATGTAGAAAGAGG + Intergenic
986697623 5:10372736-10372758 CCCAAAATTGATGAGGAAAGTGG + Intronic
986877309 5:12127183-12127205 CCTAAAAGTGATGGGGAGAATGG + Intergenic
986902901 5:12458988-12459010 CCTAAACATGAGGAGGAAAATGG - Intergenic
986917484 5:12639848-12639870 CCTGAAAGTGATGGAGAGAATGG - Intergenic
987019415 5:13853905-13853927 CCTAAAAGTGATGGGGAGAATGG + Intronic
987066445 5:14294569-14294591 ACTAATAATGCTGAAGAAAGGGG - Intronic
987544816 5:19300946-19300968 AATAAAAATGATGAGTAAAAAGG - Intergenic
987634944 5:20527294-20527316 CCCAAAAGAGATGAGGAAAATGG + Intronic
987658612 5:20841948-20841970 CCTCAAAATCATCATGAAAAGGG - Intergenic
987766040 5:22230894-22230916 CCTACGAATGATGAAGATGAAGG + Intronic
988187702 5:27888478-27888500 CCTGAAAATGATGGGGAGAATGG - Intergenic
988366984 5:30312806-30312828 CTTTAAAAAGATCAAGAAAATGG - Intergenic
988618382 5:32796542-32796564 CCTGAAAGTGATGAGGAGAATGG + Intergenic
988642191 5:33052254-33052276 TATACAAATGATGAAGAGAAAGG + Intergenic
988765072 5:34363986-34364008 CCTCAAAATCATCATGAAAAGGG + Intergenic
988970954 5:36466836-36466858 CCTGAAAGTGATGAGGAGAATGG + Intergenic
989483030 5:41954394-41954416 CATAACAATGAAGTAGAAAAAGG - Intergenic
989649506 5:43671893-43671915 CCTGAAAGTGATGAGGAGAATGG - Intronic
989653538 5:43719347-43719369 CCTGAAAGTGATGAGGAGAATGG + Intergenic
989675085 5:43964558-43964580 CCTGAAAGTGATGCAGAGAATGG - Intergenic
989843501 5:46110825-46110847 CCTGAAAGTGATGCAGAGAATGG - Intergenic
989950802 5:50295047-50295069 CCTGAAAATGATGGGGAGAATGG - Intergenic
990052502 5:51522938-51522960 CTTAAAAATGATGATGAAAATGG + Intergenic
990100938 5:52186180-52186202 CCAAAAAAAAATGGAGAAAATGG - Intergenic
990135136 5:52635817-52635839 CCTAAGAAAGAAGAATAAAAGGG - Intergenic
990600708 5:57356109-57356131 CCTGAAAGTGATGCAGAGAATGG - Intergenic
990721221 5:58698534-58698556 CCTGAAAGTGATGGGGAAAATGG - Intronic
990745691 5:58957695-58957717 CCTAAAAGTGATGGGGAGAATGG - Intergenic
990996969 5:61742305-61742327 CATGAAGATGATGAACAAAATGG + Intronic
991151622 5:63377350-63377372 CCTGAAAGTGATGGGGAAAATGG + Intergenic
991542102 5:67741514-67741536 CCTGAAAGTGATGAGGAGAATGG - Intergenic
991589274 5:68232290-68232312 CCTAAAAATGTGTAAGAGAAAGG + Intronic
991668860 5:69026909-69026931 GCTAAAAAAGATAAAGGAAAGGG + Intergenic
992254715 5:74910374-74910396 CCTGAAAGTGATGAGGAGAATGG - Intergenic
992584458 5:78221353-78221375 AATATAAATGATGAAGCAAAAGG + Intronic
992814507 5:80422928-80422950 TATAAAAATGCTCAAGAAAATGG - Intronic
992904921 5:81336674-81336696 CCTGAAAGAGATAAAGAAAACGG - Intronic
993283154 5:85954257-85954279 TGTAAAAATGATGAAGACTATGG - Intergenic
993504860 5:88695941-88695963 CTTAAAAATTATTAAGCAAATGG - Intergenic
993513265 5:88798246-88798268 CCTAAAAGTGATGGGGAGAATGG - Intronic
993940941 5:94058413-94058435 CCAAGAAATGATAAAGATAAAGG + Intronic
994237143 5:97375941-97375963 CCTAAAAATCAACTAGAAAAAGG + Intergenic
994586403 5:101714865-101714887 CCTGAAAATGATGGGGAGAATGG - Intergenic
994591616 5:101780867-101780889 ACTAAAAAATATGGAGAAAAGGG - Intergenic
994596149 5:101838345-101838367 CCTGAAAATGATGTTTAAAATGG + Intergenic
994654465 5:102573130-102573152 GCTAACAAGGATGAAGCAAAAGG + Intergenic
994684508 5:102932793-102932815 TCTCAAAGTTATGAAGAAAAGGG - Intronic
994865511 5:105264131-105264153 CATAAAAATGATAACTAAAATGG - Intergenic
995008744 5:107233649-107233671 CATCAAAATGAGAAAGAAAATGG - Intergenic
995374927 5:111463406-111463428 CCTAAAAACTCTGAAGACAAAGG + Intronic
995407474 5:111815508-111815530 CGTAAATATATTGAAGAAAATGG + Intronic
995439979 5:112180845-112180867 CCTACAAATGAATAAGAAAAAGG + Intronic
995607504 5:113872718-113872740 CATAAAAGTGGTGAGGAAAAGGG - Intergenic
995694965 5:114868300-114868322 CCTGAAAAAGATGAGGAGAATGG + Intergenic
995884655 5:116880458-116880480 CAAAAAAAGGATGAAGAAATGGG + Intergenic
996109417 5:119547591-119547613 CACCAAAATGATGAAGACAAAGG - Intronic
996251601 5:121341823-121341845 CATAAAAATCAGGAAGAAAAAGG - Intergenic
996427755 5:123333942-123333964 CCTGAAAGTGATGGGGAAAATGG - Intergenic
996788744 5:127269621-127269643 CCTGAAAGTGATGGAGAGAATGG + Intergenic
996954442 5:129165623-129165645 CCTATAAATAATGATGAAAGTGG - Intergenic
997581073 5:135017437-135017459 CATTAAAATGAAAAAGAAAAGGG + Intergenic
997807416 5:136932829-136932851 CCTGAAAGTGATGGAGAAAATGG + Intergenic
998281735 5:140816034-140816056 CCCAAATATGAGGAAGGAAATGG - Intronic
998922668 5:147086722-147086744 GCTAAAAAAGATTATGAAAAGGG - Intergenic
998942845 5:147303667-147303689 CCACAAAATGATCAAGGAAATGG + Intronic
998970211 5:147583045-147583067 CATAAAAATATTGAAAAAAAGGG - Intergenic
998972619 5:147609785-147609807 CCTGAAAGTGATGGAGAGAATGG - Intronic
999138348 5:149339139-149339161 TATGAAAATGATGATGAAAATGG + Intronic
999358968 5:150965644-150965666 CCTGAAAGTGATGGAGAGAATGG + Intergenic
999608038 5:153338066-153338088 CCTGAAAATGATGGGGAGAATGG - Intergenic
999959016 5:156734488-156734510 CCTGAAAAAGATGAGGAGAATGG - Intronic
1000214426 5:159141077-159141099 CCTGAAAGTGACGAAGAGAATGG + Intergenic
1000531881 5:162432879-162432901 CCTAAAAATCAGTAGGAAAAAGG - Intergenic
1000553491 5:162695376-162695398 CCTGAAAGTGATGGAGATAATGG - Intergenic
1000770337 5:165345622-165345644 CATAAAAATGAAGAAAATAATGG + Intergenic
1001120665 5:168977392-168977414 CCCAAAGAAGATGAAGACAATGG - Intronic
1001150528 5:169223714-169223736 TCCAAAAATGATGTACAAAATGG + Intronic
1001372461 5:171219499-171219521 CCTGAAAGTGATGAGGAGAATGG - Intronic
1001377113 5:171271046-171271068 CATAAAAAGGAGGGAGAAAAGGG - Intronic
1001480056 5:172082325-172082347 GCTCAAACTGATGAAGAAAGAGG - Exonic
1001750390 5:174125685-174125707 TATAAAAATGATGAAGTTAAGGG + Intronic
1001898205 5:175399165-175399187 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1002063353 5:176639608-176639630 TCTAGATCTGATGAAGAAAAAGG - Intronic
1002691660 5:181054203-181054225 AAAAAAAAAGATGAAGAAAAGGG - Intronic
1002919515 6:1556792-1556814 TCTGAAAATGATGAAAAGAAGGG - Intergenic
1003488041 6:6596349-6596371 CCTAATAATTCTGAAGGAAATGG + Intronic
1004242539 6:13938315-13938337 CATAAAAATCAATAAGAAAAAGG - Intronic
1004893159 6:20121432-20121454 CCCAAAAAAGACAAAGAAAAGGG + Intronic
1005044378 6:21628158-21628180 CTTAAAAATGAATAAGTAAAAGG + Intergenic
1005085392 6:22001222-22001244 AAAAAAAATGATGAAGCAAAGGG + Intergenic
1005239306 6:23805446-23805468 CCTGAAAATGACGGAGAGAATGG + Intergenic
1005413646 6:25577968-25577990 CCAAAAAAGTATGAGGAAAAAGG - Intronic
1006280551 6:33049743-33049765 CCTGAAAATGAAGGTGAAAAAGG + Intergenic
1006490515 6:34383213-34383235 CTTAGCAATGATGAATAAAAAGG - Intronic
1006576342 6:35049198-35049220 CGTAAAAATGAGGAGGGAAAGGG + Intronic
1006607762 6:35271015-35271037 CCAAAACATAATGAAAAAAATGG - Intronic
1006734236 6:36261133-36261155 ATTAAAAATGATCATGAAAATGG - Intronic
1006941923 6:37757715-37757737 CCTACAAATCAATAAGAAAAAGG + Intergenic
1007137314 6:39534594-39534616 CCTAAAAGTGATGGGGAGAATGG + Intronic
1007621822 6:43220169-43220191 GGTAAAAATAATTAAGAAAAAGG - Intronic
1008119765 6:47598571-47598593 CGTAAAAAAGATGGAAAAAATGG + Intronic
1008169853 6:48190014-48190036 CTTAAAAATTATGAAGTACAAGG - Intergenic
1008299654 6:49819800-49819822 CCTAAAAATGCTGCATAACAAGG + Intergenic
1008429206 6:51394960-51394982 CCTAGAAATGAGAAAGGAAAAGG + Intergenic
1008436720 6:51484976-51484998 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1008798896 6:55342056-55342078 CCTGAAAGTGATGGGGAAAATGG + Intronic
1008837557 6:55854089-55854111 TCTGAAATTGATGGAGAAAAAGG + Intronic
1008876736 6:56337915-56337937 ACTCAAAGTGAGGAAGAAAAGGG + Intronic
1009024908 6:57987235-57987257 CCTAGAATGGATGAAAAAAATGG - Intergenic
1009045317 6:58231208-58231230 TCTGAAAATGATGAGGAGAATGG - Intergenic
1009200483 6:60738693-60738715 CCTAGAATGGATGAAAAAAATGG - Intergenic
1009200683 6:60741475-60741497 TCTACAAAAGATCAAGAAAAAGG + Intergenic
1009492866 6:64313415-64313437 CCTGAAAATGATGGGGAGAATGG + Intronic
1009514940 6:64603308-64603330 TCTTGAAATGAAGAAGAAAAAGG - Intronic
1009662524 6:66632351-66632373 CCTGAAAATGATGGGGAGAATGG + Intergenic
1009709462 6:67299269-67299291 CCTGAAACTGATGAGGAGAATGG - Intergenic
1010332615 6:74642015-74642037 ACTAAAGATGAAGAAGACAAAGG + Intergenic
1010592744 6:77729661-77729683 CCTATAAATGCTGAATAAAAAGG - Intronic
1011011563 6:82709673-82709695 CCTAAAAAAATTGAAGAGAAGGG - Intergenic
1011012403 6:82716732-82716754 CCTGAAAGTGATGGGGAAAATGG + Intergenic
1011036675 6:82984733-82984755 TCTACAAATAAAGAAGAAAAAGG - Intronic
1011317874 6:86056423-86056445 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1011380044 6:86732918-86732940 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1011414239 6:87101071-87101093 TCTAAAAATGCTGGAGAAATAGG - Intergenic
1011760848 6:90563602-90563624 CCTGAAAGTGATGGAGAGAATGG + Intronic
1011807581 6:91089443-91089465 CCGAAAAATGATGAAAAATGAGG - Intergenic
1012129520 6:95472949-95472971 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1012231835 6:96768988-96769010 CCTGAAAAAGATGAGGAGAATGG + Intergenic
1012304269 6:97631021-97631043 CCTAAAAATAATAATTAAAAAGG - Intergenic
1012587674 6:100944214-100944236 CCTCAAAATAAACAAGAAAAGGG + Intergenic
1012660824 6:101888512-101888534 TCTAAAAACTAGGAAGAAAAAGG - Intronic
1012833333 6:104233122-104233144 CTTAAAAATGACTAACAAAATGG + Intergenic
1012902854 6:105027932-105027954 CCTAAAAATGTCAATGAAAATGG - Intronic
1013002549 6:106038498-106038520 GAGAAAAATGAAGAAGAAAAGGG + Intergenic
1013025198 6:106264373-106264395 CCTGAAAATGATGGGGAAAATGG + Intronic
1013038151 6:106406411-106406433 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1013323045 6:109013926-109013948 CCAAAACATGATGTTGAAAAGGG - Intronic
1013358991 6:109376027-109376049 CTTAAAAATACTGAAGGAAAAGG + Intronic
1013390407 6:109680487-109680509 CCTGAAAGTGATGAGGAGAATGG + Intronic
1013672753 6:112422897-112422919 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1013889540 6:115009846-115009868 CCTAAAAGTGATGGGGAGAATGG + Intergenic
1013895419 6:115082102-115082124 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1013919996 6:115393211-115393233 CCTGAAAGTGATGGAGAGAAAGG - Intergenic
1013966501 6:115961427-115961449 CCTAAAAGTGATGTGGAGAATGG + Intronic
1014223383 6:118821728-118821750 CCTGAAAATGATGGGGAGAATGG - Intronic
1014373472 6:120642104-120642126 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1014377155 6:120690140-120690162 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1014459917 6:121683872-121683894 CCTGTAAATGGTGAAGATAAAGG + Intergenic
1014595334 6:123329900-123329922 ACTAAAAATTAGGAAGAAAATGG + Intronic
1015247212 6:131087855-131087877 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1015354005 6:132255609-132255631 GCCAAAAATGAAGAAGAAAGAGG - Intergenic
1015586470 6:134781652-134781674 CCTTAGAAAGATGAGGAAAATGG + Intergenic
1015622734 6:135149197-135149219 CTTAAAAAGGAAGAAGAAAGAGG + Intergenic
1015639049 6:135310973-135310995 CCTAAAAATGGTTAAAAAATAGG + Intronic
1015668883 6:135665254-135665276 CCTAAAAATGAGAGTGAAAAAGG + Intergenic
1015893108 6:137988774-137988796 CCTGAAAATGATGGGGAGAATGG - Intergenic
1016023518 6:139260347-139260369 CCAAGAAATGATGAAGGAAGCGG - Exonic
1016121586 6:140348815-140348837 ACTCAAAATGATAAATAAAATGG + Intergenic
1016339240 6:143043691-143043713 CATAAAAATGATCAGGAATAAGG + Intergenic
1016431918 6:143994085-143994107 TCTGAAAATGATGAACAAGAAGG + Intronic
1016432651 6:144003723-144003745 ACTAAAAATCATTAACAAAAAGG + Intronic
1016616268 6:146052247-146052269 CCCATAAATGACTAAGAAAATGG - Intronic
1016651592 6:146467726-146467748 CATATTAATGATAAAGAAAATGG + Intergenic
1016717669 6:147252608-147252630 CCTAAAAGTGATGGGGAGAATGG + Intronic
1016860465 6:148713672-148713694 CATAAAAATGAGCAAGATAAAGG - Intergenic
1017240328 6:152161122-152161144 CCAAAAAAGAATAAAGAAAATGG + Intronic
1017305940 6:152918417-152918439 CCCAAAAATGAAAAACAAAATGG - Intergenic
1017829074 6:158108580-158108602 CAAAAAAGTGATGAAGGAAAAGG - Intergenic
1018050627 6:160005561-160005583 CCTGAAAAGGAGGCAGAAAAAGG - Intronic
1018436818 6:163767366-163767388 CCAAAAAAAAATTAAGAAAATGG - Intergenic
1018805965 6:167259825-167259847 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1020608460 7:10366340-10366362 CCTGAAAATGATGGGGAGAATGG - Intergenic
1020629941 7:10627204-10627226 CCTAAAAGTGATGGGGAGAATGG + Intergenic
1020740042 7:12004421-12004443 TCTGAAAAAGATGAACAAAATGG - Intergenic
1020795699 7:12676428-12676450 CCTGAAAATGATGTGGAGAATGG + Intergenic
1020933042 7:14424390-14424412 AAAAAAAAAGATGAAGAAAATGG - Intronic
1021282563 7:18738869-18738891 CCTGAAAGTGATGAGGAGAAGGG - Intronic
1021657374 7:22885326-22885348 CTTAATAAAGAAGAAGAAAACGG - Intergenic
1021753338 7:23827206-23827228 CCTCAAAGTGACGAAGAGAATGG - Intronic
1021883203 7:25113498-25113520 ACTAAAAATGAAGGAGAGAATGG + Intergenic
1021914554 7:25418612-25418634 CCTGAAGATGATGGAGCAAAAGG - Intergenic
1022330320 7:29372596-29372618 TTTCAAAATGATGAAAAAAAAGG + Intronic
1022576809 7:31505810-31505832 CCTGAAAATGATGGGGAGAATGG - Intergenic
1022590135 7:31653703-31653725 CCCCAAAATTATGAAGTAAAAGG - Intronic
1022695549 7:32702134-32702156 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1022751867 7:33236903-33236925 ATTAAAAATGATGAGGTAAAAGG - Intronic
1022763520 7:33383042-33383064 CCTGAAAATGATGACAACAATGG - Intronic
1024158858 7:46653757-46653779 CCTAAAGATGATGTAGAAATGGG + Intergenic
1024172773 7:46807685-46807707 CAAAAAAAAGATGATGAAAAAGG + Intergenic
1024625351 7:51203619-51203641 CCTAAAAAAAAAGAAAAAAATGG + Intronic
1024878058 7:54049112-54049134 CTTTGAAATGATGAACAAAATGG - Intergenic
1025972160 7:66336646-66336668 CCTGAAGATGAGGAAGAAAAGGG + Intronic
1026170739 7:67951786-67951808 CCTTAAAATGATAAAGAGGAGGG + Intergenic
1026292593 7:69021512-69021534 TCTAAAATTGATATAGAAAAAGG - Intergenic
1027293400 7:76740576-76740598 CCTAGTGTTGATGAAGAAAAGGG - Intergenic
1027348329 7:77285004-77285026 TCTGAAAATGATGCAAAAAAGGG - Intronic
1027687869 7:81300345-81300367 CCTATGAATGCTGAAGAGAAAGG - Intergenic
1027723108 7:81769853-81769875 ACTAATAATGAAGAAGAAGAAGG + Intronic
1027821711 7:83054366-83054388 CCTAAAAAGGGAAAAGAAAAAGG - Intronic
1027929787 7:84517896-84517918 CCTCAAAGTGATGGAGAGAATGG + Intergenic
1028139913 7:87262433-87262455 CCTCAAAGTGATGGAGAAAATGG - Intergenic
1028141230 7:87277094-87277116 CATGCAAATGAGGAAGAAAAAGG - Intergenic
1028160733 7:87482064-87482086 CATAAAGATGTTGAAGACAAGGG + Intergenic
1028338269 7:89685228-89685250 CCAAAAAATGATTGAGGAAAAGG - Intergenic
1028627814 7:92897359-92897381 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1028639991 7:93031068-93031090 CCTGAAAGAGATGCAGAAAATGG + Intergenic
1029102794 7:98147668-98147690 AGGAAAAAGGATGAAGAAAAAGG - Intronic
1030500658 7:110355386-110355408 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1030583069 7:111384142-111384164 TCTCTAAATGATGAAGAAGAAGG + Intronic
1030617034 7:111748404-111748426 CTTAAAAACCAGGAAGAAAAAGG + Intronic
1031457615 7:122002587-122002609 ACTAAAAATATTAAAGAAAAAGG + Intronic
1031724261 7:125217553-125217575 CCCAAAAATGAGTAACAAAATGG + Intergenic
1031873926 7:127116650-127116672 TTGAAAAATGAAGAAGAAAAAGG + Intronic
1032341370 7:131076392-131076414 CCTAAAAGTCATGGACAAAAAGG - Intergenic
1032420055 7:131771561-131771583 CCTAAAAATAATTAGGAAAAAGG - Intergenic
1032421840 7:131786885-131786907 CCTAAAAATAATTAGGAAAAAGG - Intergenic
1032906189 7:136369888-136369910 GCTCAAAATGATGAGGGAAAGGG + Intergenic
1032956955 7:136983050-136983072 CCTAAAAGTGATGGGGAGAACGG - Intronic
1033393817 7:140954817-140954839 ACTAAAGATGGTTAAGAAAAGGG + Intergenic
1033399932 7:141013039-141013061 CTTAAACATGATTAAGAACAAGG - Intronic
1033701922 7:143846672-143846694 CCAGAAAATAATGAACAAAATGG + Intergenic
1033829992 7:145240535-145240557 CCTAAAAGTGATGGGGAGAATGG - Intergenic
1033960498 7:146907182-146907204 CCTGAAAATGATGTGGAGAATGG + Intronic
1034416435 7:150966973-150966995 TCTAAAGTTTATGAAGAAAAAGG + Intronic
1034504950 7:151481251-151481273 CCTAGGAATGATGATGAACATGG - Intronic
1034727264 7:153348717-153348739 CCTCAAAAAGATGAAGCATAGGG - Intergenic
1035551387 8:529913-529935 CCCAAATATGAGGAAGAAAATGG - Intronic
1036000882 8:4602267-4602289 ACTAAAAAAGAGGAAGAAAGGGG + Intronic
1036539161 8:9686866-9686888 CCTAAAAAAAATGAAGAATTTGG + Intronic
1036551353 8:9817467-9817489 CCTAAAAGTTATGAGGAGAATGG + Intergenic
1036689671 8:10937010-10937032 CCTGAAAGTGATGCAGAGAATGG - Intronic
1037006161 8:13783316-13783338 GATAAAAATAATCAAGAAAATGG - Intergenic
1037010036 8:13830022-13830044 AAAAAAAATGAAGAAGAAAATGG - Intergenic
1037033440 8:14137712-14137734 CCTAAAAGTGATGGGGAGAATGG + Intronic
1037046786 8:14315439-14315461 TCTAAAGATTATGAAGCAAATGG + Intronic
1037082571 8:14804611-14804633 CCTGAAAGTGATGCAGAGAATGG + Intronic
1037175806 8:15944918-15944940 TCTTTAAATGATGATGAAAATGG - Intergenic
1037185767 8:16061208-16061230 CCTCAAAATTATGACAAAAAGGG + Intergenic
1037348923 8:17928585-17928607 ACTAAAAATGCAGAAGAGAAAGG - Intronic
1037746332 8:21648022-21648044 CCTAAAAATCAACAAAAAAAAGG + Intergenic
1037774885 8:21827109-21827131 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1038221600 8:25613959-25613981 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1038302506 8:26366921-26366943 ACTAAAAATGAATACGAAAAAGG - Intronic
1038532503 8:28329922-28329944 AATAAAAATGATCAATAAAATGG - Intronic
1038735102 8:30161596-30161618 CACAAAAATCATGAAGAGAAAGG - Intronic
1038890580 8:31717728-31717750 CCTTAAAATGACAAAAAAAAAGG - Intronic
1039006890 8:33049145-33049167 CATAAAATTAATGCAGAAAAAGG + Intergenic
1039706551 8:40013342-40013364 CCTTTAGATGAGGAAGAAAAGGG + Intronic
1039925238 8:41924915-41924937 CCTATAAATCAATAAGAAAAAGG + Intergenic
1040035915 8:42869656-42869678 CCAAAAAGTGATGAACAAAGAGG + Intronic
1040077559 8:43253514-43253536 TCTAACAGCGATGAAGAAAATGG + Intergenic
1040088207 8:43367070-43367092 CCTGAAAGAGATGAGGAAAATGG + Intergenic
1040373400 8:46798841-46798863 CCTGAAAGTGATGGGGAAAATGG + Intergenic
1040415731 8:47193788-47193810 CCTAAGAAACATGAAGTAAAAGG + Intergenic
1040519941 8:48167970-48167992 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1040672397 8:49707447-49707469 CTTAAAAATGAAGAAAAAAATGG - Intergenic
1041232991 8:55772459-55772481 CATAAATAGGATGGAGAAAATGG - Intronic
1041387604 8:57320628-57320650 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1041459575 8:58097151-58097173 CCTGAAAGTGATGGGGAAAATGG - Intronic
1041548535 8:59075077-59075099 TATTAATATGATGAAGAAAACGG + Intronic
1041574878 8:59382350-59382372 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1041583805 8:59493731-59493753 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1041642178 8:60214989-60215011 CAGAAAAAGGAGGAAGAAAAGGG + Intronic
1041666461 8:60449596-60449618 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1041771653 8:61479190-61479212 CCTGAAAGTGATGGAGAGAATGG - Intronic
1041867276 8:62590110-62590132 CCTAAATATTAAGTAGAAAATGG + Intronic
1041900473 8:62977302-62977324 CCTAAAAGTGATGGGGAGAATGG - Intronic
1042065426 8:64869729-64869751 CCTCAAAGAGATGGAGAAAATGG + Intergenic
1042448039 8:68911441-68911463 CCTAAGAAACATGAATAAAAGGG + Intergenic
1042457335 8:69020401-69020423 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1042602871 8:70515920-70515942 AAAAAAATTGATGAAGAAAAAGG - Intergenic
1042622560 8:70722905-70722927 TCTGAAAATGATGAAGAGAATGG - Intronic
1042720497 8:71821778-71821800 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1043042490 8:75279763-75279785 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1043048635 8:75358450-75358472 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1043129265 8:76441014-76441036 CCTGAAAGTGATGGGGAAAATGG - Intergenic
1043357810 8:79434274-79434296 CCTACAAATTAAGAAGAAAAAGG - Intergenic
1043571665 8:81610734-81610756 CCTAGAAATGCTGAAGGAATAGG - Intergenic
1043665192 8:82801456-82801478 ACTAAACATGATTAAAAAAATGG + Intergenic
1043911788 8:85872884-85872906 CCTGAAAGTGACGAAGAGAATGG - Intergenic
1044227168 8:89732592-89732614 CCAGAAAATGATTAACAAAATGG + Intergenic
1044385661 8:91585247-91585269 CCTGAAAGTGACGAGGAAAATGG - Intergenic
1044405415 8:91820265-91820287 CCTGAAAGTGATGAGGACAATGG + Intergenic
1044576822 8:93778963-93778985 CCTGAAAGTGATGGGGAAAATGG - Intronic
1044596887 8:93968416-93968438 CCTGAAAGTGATGGGGAAAATGG - Intergenic
1044666214 8:94636965-94636987 TCTAAAAGTGATGAGAAAAAGGG + Intergenic
1044721282 8:95150731-95150753 CCTAAAAATACTGAAGATAAGGG - Intronic
1044805938 8:96008169-96008191 AATAAAAATAATGAAGAAATAGG - Intergenic
1044861896 8:96532204-96532226 ACTAATAATGGTGATGAAAACGG - Intronic
1045129613 8:99135144-99135166 CCAAAAAAGGATGGAGGAAACGG - Intronic
1045812761 8:106242885-106242907 TCTAAAAATGTTGAACAAATTGG + Intergenic
1045847372 8:106654249-106654271 CTTCAAAATGAAGAACAAAATGG + Intronic
1045913619 8:107440037-107440059 TCTAAACATGGGGAAGAAAAGGG - Intronic
1046079679 8:109356283-109356305 TTTAAAAATGATCAAGAAATAGG - Intergenic
1046115110 8:109775547-109775569 CCTGAAAGTGATGGGGAAAATGG - Intergenic
1046142932 8:110119478-110119500 GCTGAGAATGGTGAAGAAAAGGG + Intergenic
1046416723 8:113924949-113924971 CCTAAAAAGCATGATGAAAAAGG + Intergenic
1046437600 8:114212506-114212528 CTTAAAAATGCTAATGAAAAAGG - Intergenic
1046651532 8:116841345-116841367 GATAAAATTAATGAAGAAAAGGG - Intronic
1046879103 8:119288924-119288946 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1047142399 8:122155862-122155884 CTTAAAAATGATGAGGACATCGG + Intergenic
1047298311 8:123590395-123590417 TTTAAAAATGACCAAGAAAATGG - Intergenic
1047547753 8:125836231-125836253 GCAAAAAAGGAAGAAGAAAAGGG - Intergenic
1047827887 8:128597559-128597581 CCTATAAATGTTCAAGTAAAAGG + Intergenic
1047891544 8:129317100-129317122 ATTAAAAATGATGATGACAATGG + Intergenic
1048124166 8:131614479-131614501 CATAAAAATATGGAAGAAAATGG + Intergenic
1048126760 8:131644338-131644360 ACTTAAAATGAAGAAGAAATAGG + Intergenic
1048725950 8:137384514-137384536 CCTATAAATTTTGAAAAAAAGGG + Intergenic
1048792628 8:138117559-138117581 CCTGAAAATGATGGGGAGAATGG + Intergenic
1050127293 9:2371148-2371170 CCTAAAAATCAGTAACAAAAAGG + Intergenic
1050141397 9:2520119-2520141 CCTAAAAGTGATGGGGAGAATGG - Intergenic
1050205688 9:3194197-3194219 CCTAAAAATGATGAAGAAAGTGG - Intergenic
1050616128 9:7403430-7403452 GCTATAAATGATGAAGATGAAGG - Intergenic
1050678555 9:8084065-8084087 CCTGAAAATGATGGGGAGAATGG - Intergenic
1050756889 9:9015748-9015770 CTTAAAGAAGATGAAGAGAATGG + Intronic
1051116085 9:13696464-13696486 CCTAAAAGAGACGAGGAAAATGG - Intergenic
1051172664 9:14334533-14334555 CCTACAAATCAACAAGAAAAAGG - Intronic
1051317784 9:15861342-15861364 ACAGAAAATGATGAACAAAATGG - Intronic
1051452647 9:17214664-17214686 CCTGAAAATGATGGGGACAATGG - Intronic
1051674387 9:19545035-19545057 CCTGAAAGTGATGGAGAGAATGG - Intronic
1051950413 9:22624128-22624150 ACTAAAAATGAAAAACAAAATGG + Intergenic
1052140327 9:24973876-24973898 CTTAAAAATGATGAGAAGAAAGG + Intergenic
1052173484 9:25429089-25429111 CCTGAAAAAGATGAGGAGAATGG + Intergenic
1052479573 9:29006529-29006551 CATAAAAATCATTAATAAAAGGG + Intergenic
1052502802 9:29314091-29314113 CCAAAAAATGCAGAAAAAAACGG + Intergenic
1052608835 9:30742568-30742590 CACACAAATGAGGAAGAAAAAGG - Intergenic
1052710874 9:32053977-32053999 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1052773652 9:32711773-32711795 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1053718131 9:40917310-40917332 CCTGAAAAAGATGGAGAGAATGG + Intergenic
1053781837 9:41617956-41617978 CCTAAAAAGGATAGAGAAAATGG + Intergenic
1053782489 9:41625007-41625029 CCTAAAAATGATGGGAAAAATGG - Intergenic
1054169788 9:61828110-61828132 CCTAAAAAGGATAGAGAAAATGG + Intergenic
1054170445 9:61835164-61835186 CCTAAAAATGATGGGAAAAATGG - Intergenic
1054578822 9:66890013-66890035 TCTAAAAATGATAAAAAATAAGG - Intronic
1054667092 9:67745651-67745673 CCTAAAAATGATGGGAAAAATGG + Intergenic
1054667750 9:67752705-67752727 CCTAAAAAGGATAGAGAAAATGG - Intergenic
1054726471 9:68656889-68656911 CCCAAAAAGGAAGAAGAAAGAGG + Intergenic
1055077599 9:72232201-72232223 CTTAAATATGAGGAAGATAAAGG - Intronic
1055204769 9:73714957-73714979 CCTAAAAAGAAAGAAGAAAATGG - Intergenic
1056118857 9:83467180-83467202 CTTACAAATTATGGAGAAAATGG + Intronic
1056485505 9:87053069-87053091 TCTAAAAAATAAGAAGAAAAGGG + Intergenic
1056908917 9:90680132-90680154 CCTGAAGATGATGGAAAAAAGGG - Intergenic
1057671487 9:97093847-97093869 CCTAAGTACGGTGAAGAAAAGGG - Intergenic
1058034425 9:100235976-100235998 CCTGAAAGTGATGAGGAGAATGG - Intronic
1058074471 9:100636874-100636896 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1058253026 9:102725833-102725855 CCTAAAAAAGAGAAATAAAAGGG - Intergenic
1058338179 9:103859967-103859989 CCTGAAAGTGATGACGACAATGG - Intergenic
1058809636 9:108627039-108627061 CCTCAAATTTATCAAGAAAAGGG + Intergenic
1060326130 9:122617598-122617620 CCTAAAAGTGATGGGGAGAATGG - Intergenic
1060334581 9:122710122-122710144 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1060706778 9:125809824-125809846 CCTATAAATTATTATGAAAAAGG + Intronic
1062306471 9:135909716-135909738 TCTAAAAATCATTAAAAAAAAGG + Intergenic
1062626216 9:137443238-137443260 CTTTGAAATGATGAATAAAATGG - Intergenic
1185472483 X:392589-392611 CCTAAGAAGGATTTAGAAAAGGG + Intergenic
1185582678 X:1223078-1223100 GATAAAGATGATGAAGAAAAAGG - Intergenic
1186140292 X:6564783-6564805 CCTAGAAAGGATGTGGAAAAAGG + Intergenic
1186181153 X:6974820-6974842 CCTGAAAATGACGGGGAAAATGG - Intergenic
1186791464 X:13003754-13003776 CCTATAACAGATGAAAAAAATGG - Intergenic
1187197497 X:17101492-17101514 CCCAAATATGAAGAAGAAATAGG - Intronic
1187436735 X:19277975-19277997 CCTAAAAGTGATGGGGAGAATGG - Intergenic
1187516587 X:19976727-19976749 CCAAAAAACCATGAAGCAAAAGG + Intergenic
1188243681 X:27817511-27817533 AATAAAAATTAAGAAGAAAAAGG - Intronic
1188573012 X:31611977-31611999 CTTAAAAATGGTCAAGAAAATGG - Intronic
1188814283 X:34692090-34692112 CCAGAAAATGATAAACAAAATGG - Intergenic
1188843186 X:35040871-35040893 TCTAAAAAAAATGAGGAAAAGGG + Intergenic
1189275135 X:39779907-39779929 CCTAAGAATGAAGGAGAAAAAGG - Intergenic
1189458328 X:41214546-41214568 CCTAAAAACGATTTAAAAAAAGG - Exonic
1189498495 X:41531173-41531195 CCAAAGAAAGACGAAGAAAATGG - Exonic
1189936894 X:46079195-46079217 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1190039076 X:47054530-47054552 CCAAAGGAGGATGAAGAAAATGG + Exonic
1190165559 X:48070637-48070659 CCTACAAATCATTAAGAAAAGGG + Intronic
1190191920 X:48283946-48283968 TGTTAAAATGATGAAAAAAAGGG - Intergenic
1190499140 X:51057936-51057958 TCTAAAAACCTTGAAGAAAATGG - Intergenic
1190920430 X:54846385-54846407 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1190924399 X:54889015-54889037 CCTGAAAAGGATGGAGAGAATGG + Intergenic
1191172299 X:57460190-57460212 CCTGAAAGTGATGAGGAGAATGG + Intronic
1191180513 X:57558363-57558385 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1191698782 X:64017869-64017891 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1191705266 X:64087149-64087171 CCTAAAAGTGATGAGGAGAATGG + Intergenic
1191725264 X:64272633-64272655 CCTAAATCTGAGGAAGGAAATGG + Intronic
1191725631 X:64277836-64277858 CCTGAAAGTGATGAGGAGAATGG - Intronic
1191727914 X:64301186-64301208 CCTGAAAGTGATGAGGAGAATGG - Intronic
1191788610 X:64944687-64944709 CCTAAAAGTGATGGGGAGAATGG - Intronic
1191793938 X:65000968-65000990 CCTGAAAGTGATGGGGAAAATGG + Intronic
1191928935 X:66347481-66347503 CCTGAAAATGATGGGGAGAATGG + Intergenic
1191982777 X:66944187-66944209 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1192023729 X:67425967-67425989 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1192071381 X:67944053-67944075 CCTGAAAGTGATGCAGAGAATGG + Intergenic
1192721470 X:73702947-73702969 CCTGAAAGTGATGGGGAAAATGG + Intergenic
1192931962 X:75815714-75815736 CCTGAAAATGATGGGGAGAATGG + Intergenic
1192934679 X:75847305-75847327 CCTGAAAAAGATGAGGAGAATGG - Intergenic
1192949927 X:76006433-76006455 CCTGAAAGTGATGCAGAGAATGG - Intergenic
1192960789 X:76128376-76128398 CCTAAAACAGATGAGGAGAATGG + Intergenic
1192976293 X:76289388-76289410 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1193072466 X:77320399-77320421 CCTAAAAGTGATGGGGATAATGG + Intergenic
1193361556 X:80585480-80585502 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1193509929 X:82387120-82387142 CCTAGAACTGATTATGAAAAGGG - Intergenic
1193678785 X:84491018-84491040 AATAAGAACGATGAAGAAAATGG - Intronic
1193830159 X:86279985-86280007 CCTGAAAGTGATGGGGAAAATGG + Intronic
1193897418 X:87130122-87130144 CCTGAAAGTGATGGGGAAAATGG + Intergenic
1193913332 X:87332520-87332542 GCCAAGAATGAAGAAGAAAAAGG - Intergenic
1193925429 X:87478427-87478449 CCAGAAAATGATTAAGAATATGG - Intergenic
1193991205 X:88309895-88309917 CCTGAAAGTGATGGAGAGAATGG + Intergenic
1194028713 X:88786023-88786045 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1194157695 X:90413847-90413869 ATTTAAAATGCTGAAGAAAAAGG - Intergenic
1194176775 X:90660184-90660206 CCAGAAAATAATGAACAAAATGG - Intergenic
1194262330 X:91711691-91711713 CCAGAAAATGATGAAAACAAAGG + Intergenic
1194315126 X:92368102-92368124 CCTGAAAGTGATGGGGAAAATGG - Intronic
1194457758 X:94125359-94125381 ACAAAGAATGATGAATAAAAAGG + Intergenic
1194706702 X:97183827-97183849 CAAAAAAATGAGAAAGAAAATGG + Intronic
1195102466 X:101568370-101568392 CCTGAAAGTGATGGGGAAAATGG + Intergenic
1195244358 X:102982207-102982229 CCTTAGAATGAGGCAGAAAATGG - Intergenic
1196002381 X:110799720-110799742 CCTAAAAAAGAGGAATAAAGTGG - Intergenic
1196198701 X:112861702-112861724 GATAAAAATGATAAAGCAAATGG + Intergenic
1196587369 X:117444956-117444978 CCTAAAAGTGATGGGGAGAATGG + Intergenic
1196626071 X:117878610-117878632 CCTAAAAGTGATGGGGAGAATGG - Intergenic
1197060802 X:122178335-122178357 GCTAAAATTGATGAAAATAATGG + Intergenic
1197171876 X:123443816-123443838 CATAAAAAGAAAGAAGAAAATGG + Intronic
1197191247 X:123649838-123649860 CCTGAAAGTGACGAAGAGAATGG + Intronic
1197257323 X:124277071-124277093 CCTGTAAATCAAGAAGAAAAAGG + Intronic
1197404085 X:126028663-126028685 CCTAAAAAAGATGGGGAGAATGG - Intergenic
1197466290 X:126807675-126807697 CCTAAATATGATGAGGATATAGG - Intergenic
1197491349 X:127121312-127121334 CCTGAAAGTGATGCAGAGAATGG - Intergenic
1197498426 X:127215272-127215294 CCTCAAAATGATGGGGAGAATGG + Intergenic
1197637884 X:128936191-128936213 TCTACAAATGATGAATAAATTGG - Intergenic
1197801600 X:130355494-130355516 CCTTAAAATAATTCAGAAAAAGG - Intronic
1198189908 X:134292607-134292629 CACAAAAATGATTAACAAAATGG - Intergenic
1198335669 X:135664119-135664141 CCTAAAAGTGATGAGGAGAATGG - Intergenic
1198609520 X:138382618-138382640 TCTAAAAATCATGGAGAAGAGGG + Intergenic
1198670880 X:139079558-139079580 CACAAAAATGATGAAGAATTTGG + Intronic
1198795739 X:140391896-140391918 CCAAAAACAGATTAAGAAAAAGG - Intergenic
1198999733 X:142620624-142620646 CCAAAACATGAAGAAGATAAGGG - Intergenic
1199115125 X:143983019-143983041 TCAAAAAATCATCAAGAAAATGG - Intergenic
1199292476 X:146120392-146120414 CCTGAAAATGATGGGGAGAATGG + Intergenic
1199991253 X:152988861-152988883 ACTGAAACTGCTGAAGAAAAGGG + Exonic
1200345613 X:155444105-155444127 CCTACAAATAAAGAAGAGAATGG + Intergenic
1200504027 Y:3990823-3990845 ATTTAAAATGCTGAAGAAAAAGG - Intergenic
1200504997 Y:4000928-4000950 CCTGAAAGTGATGGGGAAAATGG + Intergenic
1200581621 Y:4956524-4956546 CCAGAAAATGATGAAAACAAAGG + Intergenic
1200623178 Y:5479639-5479661 CCTGAAAGTGATGGGGAAAATGG - Intronic
1200689551 Y:6293369-6293391 CCTAAAAGTGACGTAGAGAATGG - Intergenic
1200771931 Y:7134397-7134419 ACTAAAAGTGATGATGAGAATGG - Intergenic
1201045721 Y:9881351-9881373 CCTAAAAGTGACGTAGAGAATGG + Intergenic
1201363907 Y:13183699-13183721 CCTGAAAGTGATGAGGAGAATGG - Intergenic
1201412445 Y:13713598-13713620 CCTTTAAATGATGCAGAAGAGGG - Intergenic
1201523521 Y:14903987-14904009 AATAATAATGATGATGAAAATGG + Intergenic
1201590806 Y:15612401-15612423 CCTGAAAGTGATGAGGAGAATGG + Intergenic
1201854177 Y:18522515-18522537 CCTATAAGTGATGGGGAAAATGG + Intergenic
1201879144 Y:18797869-18797891 CCTATAAGTGATGGGGAAAATGG - Intronic
1201919428 Y:19218563-19218585 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1201933274 Y:19377896-19377918 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1201936625 Y:19417608-19417630 CCTGAAAGTGATGGAGAGAATGG - Intergenic
1201938829 Y:19436391-19436413 CCTGAAAATGATGGGGAGAAGGG + Intergenic
1201959322 Y:19661379-19661401 CCTTAAAGTGATGTGGAAAATGG + Intergenic
1201979201 Y:19889568-19889590 CCTGAAAGTGATGGGGAAAATGG - Intergenic
1202068636 Y:20967623-20967645 CCTAAAAATGAAGTTGAAAAAGG + Intergenic