ID: 1082792564

View in Genome Browser
Species Human (GRCh38)
Location 11:57356845-57356867
Sequence TGATGCAATTAGAGTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082792560_1082792564 19 Left 1082792560 11:57356803-57356825 CCATAATCCATTTTCTTCATCAT 0: 1
1: 1
2: 5
3: 405
4: 861
Right 1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG 0: 1
1: 0
2: 0
3: 11
4: 114
1082792561_1082792564 12 Left 1082792561 11:57356810-57356832 CCATTTTCTTCATCATTTTTAGG 0: 1
1: 1
2: 7
3: 95
4: 1084
Right 1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG 0: 1
1: 0
2: 0
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082792564 Original CRISPR TGATGCAATTAGAGTGATCT TGG Intronic
900790700 1:4678209-4678231 TGAAGCAGTTAGAGTGGTGTTGG + Intronic
909853842 1:80503710-80503732 TTATGCATTAAGAATGATCTAGG - Intergenic
910753764 1:90663523-90663545 TGATGCTAATACAGTGAGCTAGG - Intergenic
912581112 1:110721817-110721839 TGATGCTAATAGACTGATTTTGG + Intergenic
916169374 1:161989081-161989103 TGGCGCAATTGGAGTGATCCAGG - Intronic
917208207 1:172600755-172600777 TGCTTTAGTTAGAGTGATCTTGG + Intronic
922056316 1:222045587-222045609 TGATGCACTCAGAGTGTTCAAGG + Intergenic
1063375004 10:5549070-5549092 TGAATCACTTAGAGTGAACTGGG - Intergenic
1065663387 10:28030536-28030558 TAATCAAATTAGAGTAATCTGGG - Intergenic
1068384259 10:56303930-56303952 TGCTGCAAGTAGAGCCATCTGGG - Intergenic
1075420093 10:122294261-122294283 TGATGCTATCAGAGTGACCTGGG - Intronic
1078041807 11:7871309-7871331 CCATGCATTTAGAGTGCTCTAGG + Intergenic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1088235438 11:107718358-107718380 TGATGCATTTTGAGTGATGGAGG + Intronic
1088535053 11:110851520-110851542 TGATGCTAATATAGTGACCTAGG + Intergenic
1088832812 11:113551963-113551985 TACTGCACTTAGAGTGTTCTTGG - Intergenic
1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG + Intergenic
1090099279 11:123776874-123776896 AAATGAAATTAGAATGATCTGGG + Intergenic
1091161268 11:133423209-133423231 TGAGGCAATTAAAATGATCAAGG - Intronic
1095675200 12:44908642-44908664 GGATGAAATTAAAGTGATCCAGG + Intronic
1098717256 12:73845959-73845981 TGATGTAAAAAGAGTGATCAAGG + Intergenic
1099910154 12:88821194-88821216 GGATGAAATAAGACTGATCTTGG + Intergenic
1103174106 12:118846946-118846968 TGATGACAGGAGAGTGATCTTGG + Intergenic
1118866436 14:69707896-69707918 TGAGGCAATGGGAGTGATTTTGG + Intronic
1119032370 14:71202799-71202821 TGAGGCAAGTAGGGTGATGTGGG + Intergenic
1120634759 14:86938139-86938161 TAATGCACTTACGGTGATCTTGG - Intergenic
1122337785 14:101005299-101005321 TGATGAAACTTGAGTGAGCTTGG + Intergenic
1126739259 15:51761127-51761149 TGATCCAATTATAGTGTTCTGGG + Intronic
1127266294 15:57365102-57365124 GGCTGCAATTAGAGTCACCTGGG + Intergenic
1131687983 15:94791993-94792015 TCATGCAAATATAGTGACCTGGG + Intergenic
1133846736 16:9461349-9461371 TGATGCAATGAGAAGGTTCTGGG - Intergenic
1134086675 16:11362133-11362155 TGATACTATTAGAGTTATATGGG + Intronic
1135516426 16:23139349-23139371 TGGTGTGATTAGCGTGATCTCGG - Intronic
1136455433 16:30377531-30377553 TGAAGGAAGTAGAGTGACCTGGG + Intronic
1136521070 16:30796180-30796202 TGCTGCAGTGAGTGTGATCTTGG - Intergenic
1139790690 16:69431924-69431946 TAATTTAATAAGAGTGATCTGGG + Intronic
1143872655 17:9968427-9968449 TGATGGACTTAGAGTGAGCTGGG - Intronic
1148638129 17:49164867-49164889 TGGTGCAATCACAGTGATCATGG + Intronic
1149388706 17:56168801-56168823 TGTTCCAATTAGGGTGATGTTGG - Intronic
1155829353 18:30493359-30493381 TGATGCTAATAGACTGATTTGGG - Intergenic
1158887317 18:61840511-61840533 TGATGCAATCAGATAGAACTAGG - Intronic
1159133072 18:64303392-64303414 TAAAGCACTTAGAGTGTTCTTGG - Intergenic
1166509932 19:43399387-43399409 TGATGGTTTTAGAATGATCTAGG + Intergenic
1167681488 19:50924947-50924969 AAATGCAATCAGAGAGATCTAGG + Intergenic
926474110 2:13301039-13301061 TGATGGAATTATAGTGATTATGG + Intergenic
929986228 2:46735529-46735551 TGAAATAATTAGAGTGCTCTGGG - Intronic
933227761 2:79770375-79770397 TGATGCACTTCCAGTGATTTTGG - Intronic
933608808 2:84412832-84412854 GGATGCAAATAGAGGTATCTAGG - Intergenic
936923398 2:117712242-117712264 TGAGGCAATTAGAGAGTTGTGGG + Intergenic
937016477 2:118610764-118610786 TGATGCAGTTAGCCTGACCTAGG - Intergenic
937713194 2:125001764-125001786 TGATGAACTTACAGTCATCTAGG + Intergenic
939422579 2:141992890-141992912 TGCTGAAATTACAGTGATTTAGG - Intronic
939779786 2:146431666-146431688 AGATGCAATTAGAGCTATGTTGG + Intergenic
940657128 2:156501373-156501395 TTATGGAATTAGAATGAACTTGG + Intronic
941392262 2:164928896-164928918 GGATACAGTTAGGGTGATCTTGG - Intronic
942296776 2:174525168-174525190 TGCAGCAATAAGAGTCATCTTGG - Intergenic
943121264 2:183739069-183739091 TGTTGGAATTATAGAGATCTTGG + Intergenic
944625472 2:201564233-201564255 TAATTGAATTAAAGTGATCTGGG + Intronic
1170291823 20:14778672-14778694 AGATGCAGTTAAAGTGATTTGGG + Intronic
1172861487 20:38056860-38056882 TGATGCAAAAAGAATGATTTTGG + Intronic
1177692585 21:24530947-24530969 TGAGACAATGAGAGTAATCTGGG - Intergenic
1180594945 22:16966999-16967021 TGAAGCTATCAGAGTGACCTTGG + Intronic
1182496225 22:30709835-30709857 TGATAGAATTAGACTAATCTGGG - Intronic
949477403 3:4461718-4461740 TGATCCACTCAGAGTGATCCAGG - Intronic
950228828 3:11258402-11258424 TGAGGCCATGAGAGTCATCTTGG - Intronic
951509875 3:23488575-23488597 TTATGCAATTAGAATGATACCGG + Intronic
952538127 3:34335614-34335636 TCATACAATCAGAGTGCTCTGGG + Intergenic
956971287 3:74529870-74529892 TCATGGAAGGAGAGTGATCTTGG + Intergenic
956971299 3:74530033-74530055 TCATGGAAGGAGAGTGATCTTGG + Intergenic
958723482 3:97875250-97875272 TGATGTAGTTAGAGAGTTCTTGG + Exonic
964203555 3:154145493-154145515 TGATGGAGACAGAGTGATCTTGG + Intronic
965908815 3:173745373-173745395 TGATGCAATTAGCATAAACTAGG - Intronic
968324417 3:197800136-197800158 TGGTGCGATCAGCGTGATCTTGG - Intronic
972652165 4:41028755-41028777 TCATGAAATTAGAGTGATCCTGG - Intronic
974225703 4:59040083-59040105 TGATGCAATTACAATTAGCTTGG - Intergenic
974415849 4:61606005-61606027 AGATGCAATGAGAGTGATACAGG + Intronic
974801539 4:66824954-66824976 TGATGTTATTAGGGTGATGTTGG + Intergenic
975080841 4:70278629-70278651 TTAAGCAATTAGAATAATCTTGG + Intergenic
976237328 4:82912233-82912255 TGATATATTTAGTGTGATCTTGG + Intronic
977756864 4:100682341-100682363 TCATGCAATTATAGTGATACAGG + Intronic
978611863 4:110550419-110550441 TGAGCCAATTAGAATTATCTGGG + Intronic
978851690 4:113345139-113345161 TGATGCAATATGAATGAACTTGG + Intronic
983453430 4:167934038-167934060 TGATGCAATTACAGTTTACTTGG + Intergenic
984574943 4:181437285-181437307 TGAAGCAATTAGAGATTTCTGGG + Intergenic
984842815 4:184083558-184083580 TGAGGCCATAAGAGTGCTCTGGG + Intergenic
985078265 4:186240245-186240267 TGATGTAGTTACAGTGATATAGG + Intronic
988134163 5:27147741-27147763 TGATGCTATTAGAATGATATAGG + Intergenic
988984196 5:36600855-36600877 GGATGCAATCATAGTAATCTGGG - Intergenic
992173424 5:74126151-74126173 TCATGAAATTTGAGTGATCTAGG - Intergenic
992997748 5:82349116-82349138 TGATGCAATGAGAGGATTCTAGG + Intronic
993126691 5:83844324-83844346 TGAGGCAATGAGAGTGAGATCGG - Intergenic
993769738 5:91911383-91911405 TGATGTAATGAGAACGATCTGGG - Intergenic
994968403 5:106703604-106703626 TGAAGAAATTAGAGAGATATGGG - Intergenic
996585565 5:125084200-125084222 AGATGCAATCAGAGACATCTGGG - Intergenic
997135143 5:131317546-131317568 TGATGTAGTAAGAGGGATCTTGG + Intronic
997696193 5:135862940-135862962 TGATGCAATCAGAGTGGTGTTGG + Intronic
1000004568 5:157171045-157171067 TGATGAAAGTAGAGTGAATTAGG + Intronic
1000254466 5:159524839-159524861 CGATGCTATTATAGTGGTCTTGG + Intergenic
1016889576 6:148992590-148992612 TCATGCAAATAGAGTCCTCTGGG - Intronic
1018244163 6:161805876-161805898 TGCTGCATTTAGAGTGTTCCAGG - Intronic
1018376218 6:163216204-163216226 TCATGCACTTTGAGGGATCTGGG + Intronic
1019979132 7:4608096-4608118 CTCTGCAATTAGTGTGATCTTGG + Intergenic
1020678104 7:11203885-11203907 TCATGCAATTAGGGTGAGCTGGG - Intergenic
1024937609 7:54727117-54727139 TGATGCCCTTTGAGTGACCTTGG - Intergenic
1028076520 7:86523356-86523378 AAATGTAATTAGAGTGATTTTGG - Intergenic
1029449270 7:100631868-100631890 TGATGCAACTGGAGGGAACTGGG + Exonic
1031353295 7:120761741-120761763 GGAGGCTATTACAGTGATCTAGG + Intergenic
1032445167 7:131976084-131976106 TAATGGGATTAGAGTGATCAGGG + Intergenic
1034025876 7:147703205-147703227 TGTTCTAATTAGAGTGATCTGGG - Intronic
1035872203 8:3147971-3147993 TAATGCTGTTAGGGTGATCTTGG - Intronic
1036963903 8:13275656-13275678 TGGTGCAATTCAAGTGCTCTAGG - Intronic
1039049550 8:33480597-33480619 TGATGAAATTAGGGTGATAGAGG + Intronic
1040527301 8:48236313-48236335 GGAAGCAGTTAGAGTGGTCTTGG - Intergenic
1043497477 8:80818073-80818095 TCATGTAACTAGAGAGATCTGGG - Intronic
1044323048 8:90827247-90827269 TGATTAAATTAGAGTGGTCAGGG - Intronic
1046434565 8:114170259-114170281 TGAAGAAATTAGAGTGATTTAGG + Intergenic
1046621836 8:116536567-116536589 TAATGCAATTAGAAATATCTGGG + Intergenic
1048849876 8:138634783-138634805 CCATGCAATTAGAGTGATGTTGG - Intronic
1050580176 9:7046165-7046187 TGTAGCAATTGGAGTCATCTTGG + Intronic
1055991509 9:82111188-82111210 TGATGCAATGATACTGATTTTGG + Intergenic
1188484120 X:30663798-30663820 TGCTGTAATTAGAGTAATTTTGG + Intronic
1189759200 X:44304187-44304209 TGATGTAATTAGAGAGTCCTAGG + Intronic
1195728639 X:107942749-107942771 TAAAGCATTTAGAGTGATGTTGG - Intergenic
1198556670 X:137800782-137800804 TGATGCAGTTAGGGTTAGCTTGG - Intergenic
1200259598 X:154606028-154606050 TGATGCTCTCAGAGTCATCTCGG + Intergenic