ID: 1082794907

View in Genome Browser
Species Human (GRCh38)
Location 11:57371689-57371711
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082794895_1082794907 8 Left 1082794895 11:57371658-57371680 CCCATGCCCAGGATGGTGGGGCA No data
Right 1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG No data
1082794898_1082794907 1 Left 1082794898 11:57371665-57371687 CCAGGATGGTGGGGCATATCTCC No data
Right 1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG No data
1082794889_1082794907 15 Left 1082794889 11:57371651-57371673 CCACAGCCCCATGCCCAGGATGG No data
Right 1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG No data
1082794894_1082794907 9 Left 1082794894 11:57371657-57371679 CCCCATGCCCAGGATGGTGGGGC No data
Right 1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG No data
1082794885_1082794907 22 Left 1082794885 11:57371644-57371666 CCCTAACCCACAGCCCCATGCCC No data
Right 1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG No data
1082794886_1082794907 21 Left 1082794886 11:57371645-57371667 CCTAACCCACAGCCCCATGCCCA No data
Right 1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG No data
1082794888_1082794907 16 Left 1082794888 11:57371650-57371672 CCCACAGCCCCATGCCCAGGATG No data
Right 1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG No data
1082794897_1082794907 2 Left 1082794897 11:57371664-57371686 CCCAGGATGGTGGGGCATATCTC No data
Right 1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG No data
1082794896_1082794907 7 Left 1082794896 11:57371659-57371681 CCATGCCCAGGATGGTGGGGCAT No data
Right 1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082794907 Original CRISPR CAGGGTCAGCCTTGGGAATT GGG Intergenic