ID: 1082796446

View in Genome Browser
Species Human (GRCh38)
Location 11:57381349-57381371
Sequence ACACCCTGGTTTGCTTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082796440_1082796446 1 Left 1082796440 11:57381325-57381347 CCTACTGCCTTGTTTGGGTACCC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1082796446 11:57381349-57381371 ACACCCTGGTTTGCTTCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 116
1082796441_1082796446 -6 Left 1082796441 11:57381332-57381354 CCTTGTTTGGGTACCCCACACCC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1082796446 11:57381349-57381371 ACACCCTGGTTTGCTTCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 116
1082796435_1082796446 15 Left 1082796435 11:57381311-57381333 CCTGCCTCCTGGGGCCTACTGCC 0: 1
1: 0
2: 5
3: 38
4: 394
Right 1082796446 11:57381349-57381371 ACACCCTGGTTTGCTTCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 116
1082796436_1082796446 11 Left 1082796436 11:57381315-57381337 CCTCCTGGGGCCTACTGCCTTGT 0: 1
1: 0
2: 2
3: 9
4: 177
Right 1082796446 11:57381349-57381371 ACACCCTGGTTTGCTTCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 116
1082796437_1082796446 8 Left 1082796437 11:57381318-57381340 CCTGGGGCCTACTGCCTTGTTTG 0: 1
1: 0
2: 1
3: 27
4: 309
Right 1082796446 11:57381349-57381371 ACACCCTGGTTTGCTTCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082796446 Original CRISPR ACACCCTGGTTTGCTTCAGA AGG Intergenic
900423613 1:2566441-2566463 TGACCCTGGTTTGCTGCACAAGG - Intergenic
901471707 1:9461134-9461156 AGACCCTGGTTTCCTCGAGAGGG - Intergenic
902159572 1:14519297-14519319 ACCCTCTGCTTTGCTTTAGATGG + Intergenic
902791682 1:18773092-18773114 GGACCCAGGTTTGCTTCACATGG + Intergenic
904372809 1:30060951-30060973 ACACCCTGGGTAGCTGCAGCTGG - Intergenic
907518828 1:55010139-55010161 ACACCGTGCTTGCCTTCAGAGGG + Exonic
911743101 1:101409328-101409350 TCATCCAGGTTTGCCTCAGATGG + Intergenic
913526377 1:119697353-119697375 ACACCCTGCCCTGCTTCAGCTGG + Intronic
914863413 1:151405501-151405523 CCACCCTGGTTTTCTACAGAGGG - Exonic
918309470 1:183275459-183275481 ACTCCCAAGCTTGCTTCAGAGGG - Intronic
920222014 1:204411171-204411193 GCTCCCCGGATTGCTTCAGAAGG - Exonic
923083700 1:230684957-230684979 ACCACATGGTTTTCTTCAGAAGG + Intronic
1069471587 10:68696544-68696566 ATACCATTGTTTGCTTCAAAAGG + Intergenic
1069925839 10:71850455-71850477 ATACGTTGGTTTGGTTCAGAAGG - Intronic
1070027231 10:72643389-72643411 ACCCTCTGGTTTGATTCAGATGG + Intergenic
1070423011 10:76256382-76256404 ACACTCTGTTGTGCTTCAGTCGG + Intronic
1075661900 10:124203182-124203204 ACAACATGATTTCCTTCAGAGGG - Intergenic
1079632387 11:22693994-22694016 ACACACTGGTGTCTTTCAGAGGG + Intronic
1080474286 11:32575230-32575252 ACTCCCAGGATTCCTTCAGAGGG - Intergenic
1081372916 11:42325918-42325940 AAACCCAGGTTTTCTTCAGTAGG - Intergenic
1082177850 11:49082425-49082447 ACACCCTGATTTAGTCCAGAAGG + Intergenic
1082796446 11:57381349-57381371 ACACCCTGGTTTGCTTCAGAAGG + Intergenic
1086687866 11:89753435-89753457 ACACCCTGATTTAGTCCAGAAGG - Intergenic
1086717985 11:90086459-90086481 ACACCCTGATTTAGTCCAGAAGG + Intergenic
1087336686 11:96852461-96852483 ACAACTTGCCTTGCTTCAGATGG + Intergenic
1089615570 11:119692892-119692914 TCACCCAGGTCTGGTTCAGAGGG - Intronic
1089908805 11:122074665-122074687 TCACCCTTGTTTGCTTGAAAAGG + Intergenic
1090555208 11:127867230-127867252 ACACCCTGATGGGCTGCAGAAGG + Intergenic
1090593639 11:128297223-128297245 ACAGCCTGGCTTTCTGCAGAGGG + Intergenic
1091779958 12:3207598-3207620 AGTCCCTGGTTTGATTCAGGTGG + Intronic
1092052964 12:5485999-5486021 ACACCATGGTTTTCTGGAGAAGG + Intronic
1094429114 12:30347342-30347364 ACACACTGGGGTCCTTCAGAGGG + Intergenic
1099938867 12:89161006-89161028 TCACCCTGATTTAATTCAGATGG + Intergenic
1102948837 12:117014614-117014636 TCACCCTGGTTAGGTTCAGACGG + Intronic
1106563547 13:30866681-30866703 ACAACCTGGATTTCTTCAAATGG - Intergenic
1110058859 13:71015510-71015532 ATACATTGGTTTGGTTCAGAAGG + Intergenic
1115469799 14:33756793-33756815 ACTCTCTGTTTTCCTTCAGATGG - Intronic
1117214493 14:53536547-53536569 GCACACTGGTATGCCTCAGATGG - Intergenic
1117874941 14:60242486-60242508 ATACCCTGGTATGTCTCAGATGG - Intergenic
1119547192 14:75480454-75480476 AGACCCTGCTCTGCTTCAGGTGG + Intergenic
1122187284 14:100009813-100009835 ATACATTGGTTTGATTCAGAAGG + Intronic
1125293544 15:38176409-38176431 ACAGGCTGGTTTGCTTTAGATGG - Intergenic
1129463526 15:75711634-75711656 ACACCCTTCTCTCCTTCAGATGG - Intronic
1129721359 15:77879768-77879790 ACACCCTTCTCTCCTTCAGATGG + Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1135912983 16:26578283-26578305 ACAGCCTGGTTTGCTTTGGCAGG + Intergenic
1142219806 16:88848597-88848619 GCATCCTGGTTTTCTGCAGATGG + Intronic
1144182424 17:12764599-12764621 ACACCCTGGGTTCCTATAGAAGG + Exonic
1147452669 17:40515542-40515564 AAACACTGGTTTCCTTCAGTAGG + Intergenic
1149400570 17:56291732-56291754 TCACCCTTCCTTGCTTCAGAAGG - Intronic
1151529736 17:74696615-74696637 ACAGCCTGGGTAGCTGCAGAAGG - Intronic
1152531524 17:80922079-80922101 ACACCCCCGTGTGCTTCAGGAGG - Intronic
1157818524 18:50748735-50748757 ACACGCAGCTCTGCTTCAGAAGG + Intergenic
1159326636 18:66928459-66928481 ATTCCCTGGTTTGCTTCTCAGGG - Intergenic
1160330121 18:77983543-77983565 AGACCCTGGTTTCCCTCAGAAGG + Intergenic
1160405415 18:78642826-78642848 ACATCCTGCTTTGCTTCGCAGGG - Intergenic
1160873516 19:1287208-1287230 AGACCCTGGGATGGTTCAGAGGG - Intronic
1168401003 19:56086382-56086404 ACACCCTGATGTGCTTGAGGAGG - Intergenic
926550109 2:14291209-14291231 ACATGCTGCTGTGCTTCAGAAGG - Intergenic
927695173 2:25235006-25235028 ACACCCTGATTTGATGCAAATGG - Intronic
928117572 2:28557949-28557971 CCACCCAGGTTTGCTTCATCTGG + Intronic
929451874 2:42043312-42043334 ACACTGTGGTAAGCTTCAGAGGG - Intergenic
932197706 2:69798479-69798501 ACACCCTGGTGTTATTCAAAAGG - Intronic
932263522 2:70346528-70346550 TATCCCTGGTTTGCTTGAGAAGG - Intergenic
933997586 2:87681003-87681025 ACAACCTGGCATGCTTTAGATGG + Intergenic
936296266 2:111269867-111269889 ACAACCTGGCATGCTTTAGATGG - Intergenic
938132439 2:128728331-128728353 ACATCCTGGATTGTTACAGAAGG + Intergenic
940723065 2:157302899-157302921 CCCTGCTGGTTTGCTTCAGAAGG - Intronic
943422224 2:187680428-187680450 ACACACTGGGGTTCTTCAGAGGG + Intergenic
944278862 2:197871508-197871530 ACACCCTTGTTGGCTTAAAACGG + Intronic
947268634 2:228308409-228308431 ACACCGTGGTGTGATTCAAAGGG - Intergenic
947724814 2:232390457-232390479 ACACCCTGGGTTCTTTCAGTTGG - Intergenic
948909254 2:240994722-240994744 TCAACCTGGGGTGCTTCAGAGGG - Intergenic
1171018295 20:21561573-21561595 CCACCCTGGTCTCCTTCACAAGG - Intergenic
1173755968 20:45516287-45516309 CCAGCTTTGTTTGCTTCAGAGGG + Intergenic
1177041917 21:16123286-16123308 TAACCCTGGTATGCTTTAGAAGG + Intergenic
1179490381 21:41737281-41737303 GCACCTTGGTTTGCTCCAGCCGG + Intergenic
1179906742 21:44426641-44426663 ACTCCCTGTTTTGCGACAGACGG + Exonic
1182666555 22:31964484-31964506 ATACCCTGGTTTGCTTGGGGAGG - Intergenic
1184784662 22:46665871-46665893 CCTCCCTGGTTTGCTAGAGATGG + Intronic
950205457 3:11076808-11076830 CCTCCCTGATCTGCTTCAGAAGG + Intergenic
951997398 3:28746648-28746670 TCACCTTTGTTTGATTCAGAAGG + Intergenic
954687931 3:52380574-52380596 ACACCCTGGTAAGCCCCAGAAGG + Intronic
957746922 3:84356593-84356615 ACACCCTTGTTTGCTTGGGATGG - Intergenic
960003866 3:112762142-112762164 ACACACTGCTTTGCTCAAGATGG - Intronic
962834393 3:139174041-139174063 GCACGCTTGTTTGCTTTAGAAGG + Intronic
963706576 3:148696003-148696025 GCACCCTGGTTTGTTAGAGAAGG - Intergenic
964856085 3:161147367-161147389 GTACATTGGTTTGCTTCAGAAGG + Intronic
966689201 3:182725992-182726014 ACACCCTGGTGTTATTCAAAAGG - Intergenic
972207359 4:36792059-36792081 ACACACTGGGGTGCTTCAGAAGG - Intergenic
974594936 4:64002247-64002269 ATATTTTGGTTTGCTTCAGAAGG + Intergenic
975725118 4:77284351-77284373 ACAGCCTAGATTGCTTCACATGG - Intronic
978362102 4:107941851-107941873 ACACCCTGGCTTGTTTTAGGAGG + Intronic
983906821 4:173191942-173191964 ACACCCTGGTTTGTGGTAGAAGG + Intronic
984646927 4:182230639-182230661 ACACCCTGCTTTGCGTAGGAAGG - Intronic
984829394 4:183957842-183957864 GCACCCTGGTTTCTTTCAGGGGG + Intronic
984829406 4:183957905-183957927 GCACCCTGGTTTCTTTCAGGGGG + Intronic
984829419 4:183957968-183957990 GCACCCTGGTTTCTTTCAGGGGG + Intronic
984829432 4:183958031-183958053 GCACCCTGGTTTCTTTCAGGGGG + Intronic
984829445 4:183958094-183958116 GCACCCTGGTTTCTTTCAGGGGG + Intronic
984829457 4:183958157-183958179 GCACCCTGGTTTCTTTCAGGGGG + Intronic
985952617 5:3235341-3235363 ACAACCTGTTATGATTCAGATGG - Intergenic
988113937 5:26858378-26858400 ACACATTGGTTTGTTTCAGAGGG + Intergenic
990206841 5:53438865-53438887 ACTCTCTGGATTGCTTTAGAGGG - Intergenic
990368643 5:55094718-55094740 ACACCCTGATATACTTTAGATGG + Intergenic
1001932932 5:175686009-175686031 GCAACCAGGCTTGCTTCAGATGG - Exonic
1002461032 5:179373974-179373996 ACACCCTGGTCTCCTTCCTAGGG - Intergenic
1006837237 6:37006334-37006356 ACATCCTGGTTTGCCTCATACGG - Intronic
1008342779 6:50387869-50387891 ACACTCTGGTTTCCTCCTGAGGG - Intergenic
1010355177 6:74923933-74923955 ACACCATGGTCTGCTTCTCAGGG + Intergenic
1018363692 6:163097640-163097662 ATACATTGGTTTGGTTCAGAAGG + Intronic
1018478295 6:164165299-164165321 ACACTCTGGTTTGCTACAGCAGG + Intergenic
1019300800 7:302534-302556 CCACACTGGTTTGCTTCAACAGG + Intergenic
1021307104 7:19045632-19045654 ACTCCCTGCTTAGCCTCAGAGGG - Intronic
1023393603 7:39732832-39732854 ACACCTTGTCTTGCTGCAGATGG - Intergenic
1033044608 7:137950310-137950332 ACACCCTGGATTTCTCCAGAGGG + Intronic
1035346303 7:158201826-158201848 ATACATTGGTTTGGTTCAGAAGG - Intronic
1036193173 8:6690207-6690229 GCAGCCTGTTTTGGTTCAGACGG + Intergenic
1038206277 8:25468888-25468910 GCACCCTGATTTCCATCAGAAGG - Intronic
1038419788 8:27426162-27426184 ACAGCTTGCTTTGCTTCAAAAGG + Intronic
1042659278 8:71135677-71135699 ACACCATGGAGTGCTTCAGGTGG + Intergenic
1043379496 8:79687480-79687502 ACACCCTGGTTGGCATCAATAGG + Intergenic
1051101008 9:13521735-13521757 ACATCCTGTTTTCCTTTAGATGG + Intergenic
1051523777 9:18019892-18019914 ACACCCTGGTTAGATTCTCAAGG - Intergenic
1056470005 9:86896470-86896492 AGTCCCTGGTGTGCTACAGAAGG + Intergenic
1185699731 X:2221820-2221842 ACACCCTGGTTTTCTGCAGTGGG + Intronic
1186113588 X:6281430-6281452 ATGCCATGGTTTGCTTAAGAAGG - Intergenic
1186763147 X:12743970-12743992 ACACTTTGGTTTCCTTCAGAGGG - Intergenic
1188469436 X:30521158-30521180 ACACCTTTGTTTTCTTCAGAGGG - Intergenic
1192458052 X:71294042-71294064 CCACCCTAGTTTGCTTCTGATGG - Intronic
1196729681 X:118928269-118928291 ACATCCTGTGTGGCTTCAGATGG - Intergenic
1199973374 X:152876929-152876951 AGACCCTGCTTGGCTTCAGTAGG + Intergenic