ID: 1082796480

View in Genome Browser
Species Human (GRCh38)
Location 11:57381508-57381530
Sequence GGAGCTGGTGGGAGACAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082796466_1082796480 20 Left 1082796466 11:57381465-57381487 CCTCCTGCTGGTGGAATCCCAGA No data
Right 1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG No data
1082796470_1082796480 2 Left 1082796470 11:57381483-57381505 CCAGAGAGTGAAGTGGAGATCCC No data
Right 1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG No data
1082796469_1082796480 3 Left 1082796469 11:57381482-57381504 CCCAGAGAGTGAAGTGGAGATCC No data
Right 1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG No data
1082796464_1082796480 30 Left 1082796464 11:57381455-57381477 CCAGGAGTAGCCTCCTGCTGGTG No data
Right 1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG No data
1082796467_1082796480 17 Left 1082796467 11:57381468-57381490 CCTGCTGGTGGAATCCCAGAGAG No data
Right 1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082796480 Original CRISPR GGAGCTGGTGGGAGACAATG GGG Intergenic
No off target data available for this crispr