ID: 1082797459

View in Genome Browser
Species Human (GRCh38)
Location 11:57388434-57388456
Sequence ACCCACAGACAACACTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082797459_1082797465 2 Left 1082797459 11:57388434-57388456 CCCCCTCAGTGTTGTCTGTGGGT 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1082797465 11:57388459-57388481 CCATCTATCCCTGGTTCTTCTGG 0: 1
1: 0
2: 0
3: 14
4: 147
1082797459_1082797463 -7 Left 1082797459 11:57388434-57388456 CCCCCTCAGTGTTGTCTGTGGGT 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1082797463 11:57388450-57388472 TGTGGGTGTCCATCTATCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 133
1082797459_1082797468 14 Left 1082797459 11:57388434-57388456 CCCCCTCAGTGTTGTCTGTGGGT 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1082797468 11:57388471-57388493 GGTTCTTCTGGAGATTATACAGG 0: 1
1: 0
2: 0
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082797459 Original CRISPR ACCCACAGACAACACTGAGG GGG (reversed) Intronic
901950811 1:12744679-12744701 CCCCACAAAAAACACTGAGCTGG - Intergenic
902892042 1:19451571-19451593 ACCCTCAGACAAAACTGAGAGGG + Intronic
903240772 1:21981227-21981249 ACCCACAGCCAAGTCTGAGTAGG + Intronic
903244509 1:22005851-22005873 ACCCACAGCCAAGTCTGAGTAGG + Intronic
903833521 1:26188764-26188786 TCCCACAGACAGCAGTGAAGAGG + Exonic
903895900 1:26604247-26604269 TCCCCCAGACAAACCTGAGGTGG + Intergenic
906637274 1:47417553-47417575 ACCCACAGACAGCGCTGGGGTGG - Exonic
908143337 1:61210825-61210847 ATCTACAGGCAACACTCAGGTGG + Intronic
910207764 1:84764920-84764942 GCCCACAGACAAGGCTGAGATGG - Intergenic
910969476 1:92840807-92840829 AGCCTCAGACACTACTGAGGTGG + Intronic
911647416 1:100351893-100351915 CCCCACGCCCAACACTGAGGGGG - Intronic
913001638 1:114586510-114586532 CCCCACAGACCACTCTGATGAGG + Intronic
913326798 1:117634843-117634865 AACCACAACCAACCCTGAGGAGG - Intergenic
915780705 1:158547051-158547073 AACCAAAGACAAGACTGAGGGGG + Intergenic
918449729 1:184646902-184646924 ACTCAGAGCCAACACTGAGTGGG - Intergenic
919102777 1:193114073-193114095 ACACAAAGACAAAACTAAGGAGG - Intergenic
919171960 1:193965956-193965978 ACACACACACAACTCTGAGGGGG + Intergenic
920291906 1:204929327-204929349 ACCCCCATCCAACCCTGAGGAGG + Intronic
921612002 1:217223042-217223064 ACCCCCAGATAAGACTGAAGAGG - Intergenic
923434123 1:233952565-233952587 ACTCACAGACAAAACACAGGTGG - Intronic
923494768 1:234514413-234514435 ACCCACAGGCCACATGGAGGAGG - Intergenic
1067277439 10:44847954-44847976 ACCCACGGACAGCATGGAGGGGG + Intergenic
1068640046 10:59393499-59393521 ACCCACAGTCCAAACTGAGCTGG - Intergenic
1070462367 10:76682769-76682791 AGACACAGACACCACTGAGTGGG + Intergenic
1072621058 10:97079665-97079687 ATCCCCAGCCAACAGTGAGGAGG + Intronic
1072783248 10:98264406-98264428 ACCCCCAGACCACAGTGTGGGGG + Intronic
1073223619 10:101897186-101897208 ACCCACAGACAGAACTTAGTGGG + Intronic
1076996649 11:300285-300307 AGCCAGAGACAAGACTGGGGCGG - Intergenic
1077380116 11:2229484-2229506 CCCCACTGAGAACACTGAGGTGG + Intergenic
1078011435 11:7575995-7576017 GCCCACAGAGATCACAGAGGCGG - Intronic
1078520728 11:12060946-12060968 ACCCAGAGATAACACTGCTGAGG - Intergenic
1078662811 11:13300831-13300853 ACAAACAGACAACACTGACTTGG + Intronic
1080582128 11:33652358-33652380 AGCCACACAAAACACAGAGGGGG - Intronic
1081736547 11:45408511-45408533 TCCCACAGTCACCACTGTGGAGG + Intergenic
1082755787 11:57074970-57074992 AACCACTGTCTACACTGAGGAGG + Intergenic
1082797459 11:57388434-57388456 ACCCACAGACAACACTGAGGGGG - Intronic
1085258041 11:75188067-75188089 GCCCACAGCCAACTCTGAGTGGG + Intronic
1088654127 11:111983096-111983118 ACACAAAGACAAGAATGAGGGGG - Intronic
1088960208 11:114655827-114655849 ACCCACAGCCAATACTGAATGGG + Intergenic
1089082893 11:115792050-115792072 ATCTAGAGATAACACTGAGGAGG - Intergenic
1089958150 11:122591625-122591647 AATCACAGAAAACACTAAGGAGG + Intergenic
1091391532 12:129124-129146 ACTCCCAGACAGCACAGAGGAGG - Intronic
1095574182 12:43715869-43715891 ACCAACAGACTACACACAGGTGG - Intergenic
1098231264 12:68373962-68373984 GCCCACAGTCTACACTGAGAGGG + Intergenic
1102453603 12:113057826-113057848 ACCAAGAGACAACACGGAAGAGG + Exonic
1103829557 12:123767998-123768020 ACCCCCAGACTGCAGTGAGGAGG - Intronic
1104294052 12:127495683-127495705 CCACACAGAGAGCACTGAGGTGG - Intergenic
1105368498 13:19782469-19782491 GCCCACCGACATCACGGAGGAGG - Exonic
1105932212 13:25063127-25063149 CCACACAGAGAAAACTGAGGTGG - Intergenic
1106127064 13:26909300-26909322 CCCCACACACAGCACTGTGGAGG - Intergenic
1107103397 13:36618172-36618194 ACCAACAGAAAAGACAGAGGAGG + Intergenic
1113559506 13:111266906-111266928 AGGCACACCCAACACTGAGGCGG + Intronic
1116965874 14:51014779-51014801 ATTCAAAGACAACAGTGAGGTGG - Intronic
1117752646 14:58939552-58939574 ACCCCCATGCCACACTGAGGTGG - Intergenic
1117823597 14:59677091-59677113 ACTTGCAGACAACCCTGAGGTGG - Intronic
1117900952 14:60532568-60532590 TCCCTCAGAAAAGACTGAGGAGG + Intergenic
1118000421 14:61518007-61518029 ACCCACAGAAACCACTGGGTCGG - Intronic
1122828389 14:104383382-104383404 ACCCCCATCCAACACTGACGGGG - Intergenic
1122899368 14:104775908-104775930 TCCCAGAGACAGCCCTGAGGAGG + Intronic
1124372705 15:29112427-29112449 AGACACAGACAACTGTGAGGGGG - Intronic
1126747620 15:51842415-51842437 CACCACAGACAGCACTGAAGAGG - Intronic
1127147634 15:56041158-56041180 AGCCATTGACCACACTGAGGTGG - Intergenic
1128836246 15:70811245-70811267 ACACACAGCCAACACAGAGCGGG + Intergenic
1129181274 15:73878266-73878288 AGCCACAGACAAAAATGAGTGGG + Intronic
1132037878 15:98501704-98501726 ACCTACAGACATCACTGCTGGGG - Intronic
1132646105 16:999999-1000021 AACCTCAGACAACACCGAGGTGG + Intergenic
1133595693 16:7289121-7289143 AGCCACAGACATCTCTAAGGAGG - Intronic
1135130637 16:19851260-19851282 ACCCACCCACAGCACTGAGGGGG + Intronic
1135181281 16:20276695-20276717 ACCCCCAGACATCAGTGAGTAGG - Intergenic
1137534447 16:49307591-49307613 ACACAGGGACAACAGTGAGGAGG - Intergenic
1138344650 16:56312463-56312485 GCTCACAGCAAACACTGAGGCGG + Intronic
1138374376 16:56552621-56552643 ACCCACAGGCACTACTGATGGGG + Intergenic
1138426772 16:56939481-56939503 ACCCACAGACCAAACAGAGCAGG - Intronic
1139463641 16:67142353-67142375 ACCCACAGACTACCCAGAGCTGG + Intronic
1140852354 16:78947005-78947027 AGGCAGAGACAAGACTGAGGGGG - Intronic
1143183775 17:4998831-4998853 GCCCACGGACAACAGGGAGGAGG - Intronic
1150176776 17:63066018-63066040 ACTCACAGACAACAAGCAGGAGG - Intronic
1150563304 17:66314344-66314366 AGACACAGCCAACACTGAAGTGG - Intronic
1150656436 17:67042761-67042783 ACCCACAGGGAACACAGAGGTGG + Intergenic
1153418580 18:4878743-4878765 CCCTAAAGACAACACTGAGATGG + Intergenic
1157564120 18:48668281-48668303 ACCCACAGGAGACACTGGGGAGG + Intronic
1158215750 18:55098925-55098947 ACATACAGACAACACTGTGCTGG + Intergenic
1161740854 19:6020391-6020413 AACCACAGAGAAGACTGAAGCGG + Intronic
1162519668 19:11172427-11172449 ACCCACTGAGGACAGTGAGGAGG - Intronic
1162597414 19:11639977-11639999 CCCCAGAGACAACAGCGAGGAGG - Intergenic
1162831758 19:13289063-13289085 ACCCACTCACAAAACTGAGAAGG - Intronic
1163558770 19:18007049-18007071 ACCCACACACCTCACTGAGGTGG + Intronic
1164815694 19:31200780-31200802 ACCAACAGCCCACACTGTGGTGG - Intergenic
1165008120 19:32823153-32823175 ACCCACAGATAACACAGCTGAGG + Intronic
1165344245 19:35233840-35233862 ACCCACAGAGAACAATGATTTGG - Intergenic
1165879097 19:39030456-39030478 ATTCACAGACAAGACTGAGCTGG + Intronic
1166299845 19:41907338-41907360 CCCCACAGGCAATACTGAGATGG - Exonic
1168721364 19:58556572-58556594 AACCACAGACAACAAAGGGGTGG + Intronic
925723040 2:6846675-6846697 GCCTTCAGATAACACTGAGGGGG + Intronic
926677371 2:15637482-15637504 ACCCACAAAGAACACTGTGCTGG + Intergenic
927357984 2:22195536-22195558 ACACACAGAGGACACTGATGGGG + Intergenic
927390161 2:22585958-22585980 ACGCACAGACAAGAGGGAGGAGG + Intergenic
936622386 2:114113796-114113818 AACCAAAGCCATCACTGAGGGGG + Intergenic
937285993 2:120751644-120751666 ACCCACAGAGAACACCAACGTGG - Intronic
938184291 2:129214772-129214794 ATTCAGAGACAACACTGTGGAGG + Intergenic
939347850 2:140990611-140990633 AACCACAGAAAATACTTAGGAGG + Intronic
940599965 2:155846056-155846078 ACCCACATAAAACACTCAGCTGG - Intergenic
943292957 2:186098954-186098976 ACCCACATGCAACAGTGAGGGGG + Intergenic
946341983 2:219075888-219075910 ATCCAGAGACAACAATGGGGTGG + Exonic
948870590 2:240795964-240795986 CCCCACATGCAAGACTGAGGTGG + Intronic
1172768100 20:37361718-37361740 GATCACAGAGAACACTGAGGTGG - Intronic
1173126129 20:40337626-40337648 TCCCTCCCACAACACTGAGGAGG + Intergenic
1173538170 20:43831655-43831677 AAGCACAGACAACACAGAGGCGG + Intergenic
1173688976 20:44944384-44944406 ACCCACTGAAAACAGTGAGGTGG - Intronic
1174545138 20:51319509-51319531 CCCCACAGACCACTCTCAGGCGG + Intergenic
1174575245 20:51532644-51532666 ACACACAGCCAAGTCTGAGGTGG + Intronic
1176086323 20:63297142-63297164 ACCCACACTCCCCACTGAGGCGG + Intronic
1179607984 21:42530655-42530677 ACCTTCAGCCAACACAGAGGGGG - Intronic
1180240365 21:46499408-46499430 AGGCACAGACAACAGAGAGGCGG - Intronic
1181362576 22:22349439-22349461 ACCCCCACACATCACTGAGGTGG - Intergenic
1182096718 22:27630677-27630699 ACCCACAGGCAGCTCTGGGGTGG - Intergenic
1183840224 22:40493698-40493720 ACTCCCAGACATTACTGAGGAGG + Intronic
1184283110 22:43450126-43450148 AGCCACAGAGAACACTGAGTGGG - Intronic
1184330072 22:43821684-43821706 ACAGCCACACAACACTGAGGTGG + Intergenic
950303284 3:11899892-11899914 ACCCAAAGACAGAAGTGAGGTGG - Intergenic
950506775 3:13399963-13399985 ACCCAAAGACAGAAGTGAGGTGG + Intronic
950653418 3:14422047-14422069 CCCCTCAGACTTCACTGAGGTGG - Intronic
951502983 3:23411176-23411198 ACCCACAGCCTCAACTGAGGCGG - Intronic
952156425 3:30648452-30648474 ACACACACACAAAACTGTGGGGG + Intronic
954208266 3:49076810-49076832 ATACACAGACAGCACTGAAGTGG - Exonic
955026419 3:55171979-55172001 ACCCCCAGATGACCCTGAGGGGG - Intergenic
955520612 3:59772110-59772132 ACCCACCTCCACCACTGAGGGGG + Intronic
960718852 3:120605315-120605337 ACCCACAAACATCACTGATATGG + Intergenic
963206574 3:142642558-142642580 ACTGACAGACCACACTGATGGGG - Intronic
966460156 3:180167550-180167572 ACACACAGACAACACAGGGTGGG + Intergenic
969117738 4:4882789-4882811 ACCATCATACAACACTGACGGGG - Intergenic
969268858 4:6085329-6085351 AGCCACAGAGGACTCTGAGGTGG - Intronic
969522539 4:7686924-7686946 CCCCACAGGGAACCCTGAGGAGG + Intronic
973564605 4:52171331-52171353 ACCAACAGAGAACACAGGGGTGG - Intergenic
973598845 4:52520991-52521013 AGCCACAGTCCACACTGAGTAGG + Intergenic
975526956 4:75361451-75361473 AGCCCCAGAAAACACTGATGAGG + Intergenic
976847273 4:89504002-89504024 ACCTAGAAACAAAACTGAGGTGG + Intergenic
978770114 4:112447182-112447204 ACCCACAGCCAACAAGGAAGAGG - Intergenic
979277926 4:118834314-118834336 AACCACTGACAACACTCAAGTGG - Intronic
981453742 4:144929706-144929728 ACCCACAGCCACCACTGAATGGG - Intergenic
984514563 4:180721812-180721834 AGCCACCAACAACACTGAGCTGG + Intergenic
985952258 5:3231255-3231277 AGCCACAGACAACAGGGAGCTGG - Intergenic
990257092 5:53982034-53982056 ACCAAGAGAGAACACTAAGGAGG + Intronic
990986354 5:61644237-61644259 ACCCATAGAGAAGACTGAGAAGG + Intronic
991294106 5:65062636-65062658 TCCCACAGCCAACTCTGTGGAGG - Intergenic
993060484 5:83032648-83032670 ACCCAAAGACCACAGTGATGGGG + Intergenic
995555667 5:113325794-113325816 ATCCACAGCCAACACTGACATGG + Intronic
995804328 5:116034660-116034682 ACCCACAGAAGACACTCAGCAGG - Intronic
997873288 5:137524168-137524190 AACCACAGACAACACCAAGCAGG + Intronic
998016965 5:138740106-138740128 ACCAACAGACAAAACTAGGGTGG + Intronic
999945574 5:156591670-156591692 ACACATAGACTACACAGAGGGGG + Intronic
1000291659 5:159876758-159876780 ACCAACAGACCCCACAGAGGCGG - Intergenic
1000320272 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG + Intergenic
1003949975 6:11108169-11108191 CCCCAGAGACAGCACAGAGGAGG + Intronic
1006394114 6:33775967-33775989 AACCAGAGCCAACACTGGGGGGG + Intronic
1008398183 6:51033506-51033528 ACCCACAGCCAATACTGAAAGGG - Intergenic
1011456062 6:87550922-87550944 ACCCACAGAGGAAACTGAGATGG + Intronic
1011742538 6:90376695-90376717 ACCCACAGATGACACTGTGAAGG - Intergenic
1014664707 6:124222673-124222695 ACCAGCAGAAAAGACTGAGGAGG + Intronic
1014935810 6:127383552-127383574 ACTAACATAAAACACTGAGGTGG + Intergenic
1015380562 6:132562705-132562727 ACCCACAGATAATAATGTGGAGG + Intergenic
1018162290 6:161057214-161057236 ACACACAGGAAACACTGAAGAGG + Intronic
1022702850 7:32777640-32777662 TGCCACAGACACCACTGAGCAGG - Intergenic
1022907076 7:34867760-34867782 TGCCACAGACACCACTGAGCAGG - Intronic
1023193050 7:37603527-37603549 ACACACAGACTGCACTCAGGTGG + Intergenic
1029063320 7:97822431-97822453 ACCCAGAGAGAGCAATGAGGTGG - Intergenic
1029548484 7:101223741-101223763 AGCCACAGACAGCACAGAAGGGG - Exonic
1030818950 7:114073269-114073291 ACCCAAAGCCAATACTGAGGAGG + Intronic
1031420576 7:121546845-121546867 ACTCACAGACAGCCCGGAGGAGG - Intergenic
1032730113 7:134632848-134632870 GGCCACAGACACCTCTGAGGAGG + Intergenic
1034284556 7:149875916-149875938 AGGCACAGACAGCACTGAGGTGG - Intronic
1034557494 7:151859344-151859366 ACCCACAGACCTCACAGAGATGG - Intronic
1036189966 8:6661475-6661497 AACCTCAGCCAACGCTGAGGAGG + Intergenic
1036209980 8:6834130-6834152 AGCCTCAGACAACCCTGAGGAGG - Intronic
1036791109 8:11720876-11720898 ACCTGCAGACAACACTCAGTGGG - Intronic
1037307148 8:17516964-17516986 CCCCACAATCAACACTGAAGAGG + Intronic
1039889306 8:41673457-41673479 ACCCATAGACCTCACTGTGGTGG + Intronic
1041305405 8:56452484-56452506 AAGCCCAGACAACACTGAGCAGG + Intergenic
1043316182 8:78925062-78925084 ACCCACAGACAGCACTAAACTGG - Intergenic
1044686453 8:94830608-94830630 AGCTACTGGCAACACTGAGGTGG - Intronic
1047350762 8:124071429-124071451 ACCCACAGAGAGCACTGTGCTGG - Intronic
1047985155 8:130225611-130225633 ACACACAGACAACACTTGGATGG + Intronic
1048979660 8:139696614-139696636 ACCCACTGAGTACACAGAGGAGG + Intronic
1049211347 8:141387781-141387803 CCCCACAGAACACAGTGAGGTGG + Intergenic
1051189904 9:14500349-14500371 GCCCCAAGACAACACTGTGGGGG - Intergenic
1052247292 9:26351321-26351343 ACCCACAGCCAACACAAATGGGG + Intergenic
1053428141 9:38024578-38024600 ACCCACAGCTCACTCTGAGGGGG - Intronic
1055707579 9:79023072-79023094 ACTCATAGAAAACACTGAAGTGG - Intergenic
1060317519 9:122526549-122526571 ACACACAAACAACGCAGAGGTGG + Exonic
1187867901 X:23740754-23740776 ACACACACACCGCACTGAGGTGG + Intronic
1187901791 X:24032899-24032921 ACCCACACACAAAGCTGAGGAGG - Intergenic
1189908891 X:45789837-45789859 ATCCACAGACACCTCTTAGGAGG - Intergenic
1192609221 X:72551103-72551125 ACACACACACAAAACTGATGAGG + Intronic
1194675676 X:96790929-96790951 ACACACAGACAGCACTGATGAGG - Intronic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1197910222 X:131474707-131474729 AACCACAGACCACACTTAGAAGG - Intergenic
1198968045 X:142248975-142248997 ACCCAGGGACAACACTAAGAAGG - Intergenic