ID: 1082800456

View in Genome Browser
Species Human (GRCh38)
Location 11:57410336-57410358
Sequence CAGTGGGGTTGGAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 802
Summary {0: 1, 1: 1, 2: 23, 3: 108, 4: 669}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082800456_1082800463 16 Left 1082800456 11:57410336-57410358 CCCACTTCTCTCCAACCCCACTG 0: 1
1: 1
2: 23
3: 108
4: 669
Right 1082800463 11:57410375-57410397 AACTACCATTAACTCAGTCATGG 0: 1
1: 0
2: 2
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082800456 Original CRISPR CAGTGGGGTTGGAGAGAAGT GGG (reversed) Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901175585 1:7296467-7296489 TAGTGGGGATGGGAAGAAGTGGG + Intronic
902259891 1:15216877-15216899 CTGTGGGATTGGAGAGGGGTAGG + Intronic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902699744 1:18163661-18163683 CAATGGGGTTGCAGGGAAGTTGG - Intronic
902788654 1:18749974-18749996 CAGTGGGGTGAGAGAGTTGTTGG + Intergenic
904026213 1:27505132-27505154 CTGGGGAGTTGGAGAGAACTAGG + Intergenic
904525893 1:31133609-31133631 CATTGCGGTTGAAGAAAAGTGGG - Intergenic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
905776382 1:40669985-40670007 CAAGAGGGATGGAGAGAAGTGGG - Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906710549 1:47926672-47926694 CAGAGGGGTTGGAGAGAATGGGG + Intronic
906713222 1:47948184-47948206 CAGTGGGGATAGAGAGACTTGGG + Intronic
907085299 1:51666998-51667020 CAGAGAGGATGGAGACAAGTTGG + Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
908471155 1:64445212-64445234 CAGTGGGTTTGTAGAGACATGGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909753855 1:79198020-79198042 TAGGGGGGTTGGAGAAAAGGGGG + Intergenic
910313936 1:85860357-85860379 TAGAGGGGTTGGAAAGAAATGGG - Intronic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
912306747 1:108575802-108575824 CTGAGGGATTGGAGAGAAATGGG + Intronic
912348150 1:108985014-108985036 CAGTGGAGGTGGAGCAAAGTGGG - Intronic
912435830 1:109660391-109660413 TAGTGGGGTTGGAGATGAGGTGG + Intronic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
914213624 1:145604797-145604819 GGGTGGGGTTGGAGAGATGTTGG + Intergenic
914353922 1:146865286-146865308 CAGGGGGGGTGGAGAGATGGTGG + Intergenic
914972742 1:152325507-152325529 AAGTGGGGTTACAGAAAAGTAGG - Intergenic
915178902 1:154041270-154041292 AACTGGGATAGGAGAGAAGTAGG - Intronic
915428283 1:155845118-155845140 GAGTGAGGTAGGAGAGAAGCAGG + Intronic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
918004244 1:180526769-180526791 CAGTGGTGTGGGAGAGAAGGGGG + Intergenic
918136924 1:181681945-181681967 AAGTGTGGCTGAAGAGAAGTAGG - Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921172545 1:212562174-212562196 GATTGGGGTTGGGGAGAGGTGGG - Intergenic
921273081 1:213490107-213490129 CAGTGGGCTTGGAAAGAGCTGGG + Intergenic
921829001 1:219706233-219706255 CCGTGAGGTTGCAGAGAAGAAGG + Intronic
922386863 1:225095026-225095048 CAGTGAGGTTGCAGAGAAAAGGG + Intronic
922764318 1:228149558-228149580 CAGATGGGTGGGAGAGAAGGAGG + Intergenic
922851419 1:228736214-228736236 GAGTGGGCTTGGAGAGAGGAGGG + Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923230481 1:231981929-231981951 CAGTTGGTATGTAGAGAAGTGGG + Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923291608 1:232551587-232551609 CAGTGGGGGAGGTGAGAAGAAGG + Intronic
923437967 1:233986293-233986315 AACTTGGGGTGGAGAGAAGTTGG - Intronic
923570328 1:235107704-235107726 CAGTGAGGCTGGAAAGAAGTGGG + Intergenic
923815529 1:237373620-237373642 CATGGGGGTTGGGGAGCAGTAGG + Intronic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924074938 1:240323940-240323962 CAGTGAGGCTTGAGAGAACTTGG - Intronic
924144488 1:241060017-241060039 CTGTGGAGTGGGAGAGAAATGGG - Intronic
924273447 1:242359228-242359250 CTGTGAGGTGGGAGTGAAGTAGG + Intronic
924275461 1:242381777-242381799 CCGTGGGTTTGGAGTTAAGTGGG - Intronic
1063374887 10:5548366-5548388 AAGAGGGGGTGGAGAGAGGTGGG + Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064508478 10:16062921-16062943 CAGTGGGGGTGGATAGCATTAGG - Intergenic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065510191 10:26470770-26470792 CCGTGGGTTTGGATAGAAGCAGG - Intronic
1065668469 10:28087806-28087828 CAGTGAGGTGGGAGAGGAGCAGG + Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065780227 10:29160397-29160419 CAGAGGGGTAGGAGAGAGGAGGG + Intergenic
1066234501 10:33472034-33472056 AAGTGGGGTGGGTTAGAAGTGGG - Intergenic
1066493510 10:35918170-35918192 CAGTGGAGTTGGAGATAGGCAGG + Intergenic
1067665092 10:48270861-48270883 TGGTGGGGTTGGAGAGAAACAGG - Intronic
1067838487 10:49656685-49656707 CAGTGGGGCAGGGGAGATGTTGG + Intronic
1068491495 10:57730228-57730250 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1068519887 10:58066467-58066489 CAGGTGGGATGAAGAGAAGTGGG - Intergenic
1068815198 10:61302002-61302024 CAGTGTGGTTGGAGAAATTTTGG - Intergenic
1069229933 10:65996459-65996481 CAGTGGGGTTCTAGGGATGTAGG + Intronic
1069291649 10:66787421-66787443 GGGTGAGGTTGGACAGAAGTTGG + Intronic
1069559528 10:69419744-69419766 CTGTGGTGTGTGAGAGAAGTGGG + Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069919859 10:71810025-71810047 CAGTGATGTTGGAGAGCAGGTGG - Exonic
1070023322 10:72607757-72607779 CAGTGAGGTTGGACAGAACTGGG + Intronic
1070495293 10:77015836-77015858 GAGTGGAGGTGGAGAGAGGTGGG - Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070757370 10:79001691-79001713 CAGTGGAGTGGGAAGGAAGTGGG + Intergenic
1071067263 10:81650741-81650763 TTGTGGGGTTAGAGAGATGTTGG - Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071332091 10:84570875-84570897 CAATGGGCTGGGAGAGAAGCGGG + Intergenic
1071706946 10:88009414-88009436 AAGTGGGGATAGAGAAAAGTAGG + Intergenic
1071981965 10:91012491-91012513 CAGTATAGTTGGAGAAAAGTTGG + Intergenic
1072114529 10:92357508-92357530 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1072565345 10:96612328-96612350 CCCTGGGGTTGGAGAAAAATGGG + Intronic
1073119138 10:101111009-101111031 GGGTGGGGGTGGAGAAAAGTAGG + Intronic
1073170580 10:101504525-101504547 CAGTGGGGTTGGTGAGAGATGGG - Intronic
1073312243 10:102551324-102551346 CAGTTGAGTTGGCCAGAAGTGGG + Intronic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074476936 10:113781835-113781857 CTGTGGGGTTGAAGAGAGGCAGG - Intronic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075555369 10:123427062-123427084 AAGAGGGGTTGGAGACAAGGAGG + Intergenic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1075959138 10:126552059-126552081 CAGTGGGGGTGGAGAAACTTGGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076694542 10:132240770-132240792 CAGGGGGGTTAGAGAGGAGAGGG + Intronic
1076726072 10:132413900-132413922 CAGTGGGGTGGGAGAGAGGTAGG + Intronic
1077446558 11:2593907-2593929 CAGTGAGGTTTCAGAGGAGTTGG - Intronic
1077514804 11:2995072-2995094 CAGAGGGGTTGTAGACAGGTGGG - Intergenic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077704409 11:4470804-4470826 GAATGGGGTAGGAGAGGAGTTGG - Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078267673 11:9766968-9766990 CAGTTGGGCTGGATAGACGTGGG - Intergenic
1078298234 11:10097893-10097915 CGGTGGGGTGAGAAAGAAGTAGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079373733 11:19873335-19873357 CAGTGGGGCTACACAGAAGTGGG + Intronic
1079947021 11:26756839-26756861 CTGTGGGGTTGAGGAGAGGTTGG - Intergenic
1080360499 11:31507667-31507689 CAGGGGGGATGGGGAGAATTTGG + Intronic
1081181959 11:39994766-39994788 AAGTTGGGTTGGAGACAAGCAGG - Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081578797 11:44337356-44337378 CAGTGGGCTAGGAGAGACTTGGG + Intergenic
1081713578 11:45233407-45233429 CTGTGGGGGTGGGGAGAGGTAGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1084120773 11:67067687-67067709 CAGTGGGGGTGACGAGAAGGGGG + Intronic
1084597250 11:70124312-70124334 CAGTGGGGTTGGTGACAATGTGG - Intronic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1086074866 11:82839777-82839799 TAGTGGAGTGGGAGAGGAGTTGG - Intronic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1086123067 11:83320578-83320600 CAGTGGTGGTTGGGAGAAGTGGG - Intergenic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1086685330 11:89727802-89727824 CAGTGGGGTGGGGGACAGGTGGG - Intergenic
1086976227 11:93136357-93136379 TGGTGAGGTTGCAGAGAAGTAGG + Intergenic
1087098603 11:94344181-94344203 CAGGGGGGTGGGAGATAAATAGG - Intergenic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1088724596 11:112622914-112622936 CAGTGGGGTTGGAAATATCTTGG - Intergenic
1089314795 11:117584059-117584081 CAGGGGGGTAGGAGAGGAGGGGG - Intronic
1089688874 11:120173697-120173719 CAGTTGGCTTGGAGACAAATGGG - Intronic
1090520970 11:127478844-127478866 CAGTGGGGTTGAAGAGCATGAGG + Intergenic
1090718885 11:129454755-129454777 GAGGGAGGTTGGAGAGATGTTGG - Intergenic
1090801241 11:130173795-130173817 CAGAGGGGTTACAGAGAAGCGGG - Intronic
1091041409 11:132284763-132284785 CAGTGGCCTTGGGGAGAAGGCGG + Intronic
1091228157 11:133970580-133970602 TGGTAGGGTAGGAGAGAAGTGGG - Intergenic
1091598839 12:1904230-1904252 CGATGGGGTTGGGGAGAAGTGGG + Intronic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091669788 12:2444817-2444839 TAGTGGGATTGGTGAGATGTAGG - Intronic
1091964724 12:4729407-4729429 AAGAGGGGTTAGAGAGATGTTGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092725888 12:11485303-11485325 CACTGGTGTTTGAGAGAAGCCGG - Intronic
1092798209 12:12135338-12135360 GAGTGGAGGGGGAGAGAAGTGGG + Intronic
1094009552 12:25792826-25792848 TGATAGGGTTGGAGAGAAGTGGG + Intergenic
1094525780 12:31229718-31229740 CAGTGGGGCTGGAGAGGCGGTGG - Intergenic
1095195621 12:39312380-39312402 CAGTGGGGGTTGGGAGAGGTGGG + Intronic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1095716547 12:45352313-45352335 GAGTGGGGAGGGAAAGAAGTGGG - Intronic
1095857877 12:46881219-46881241 CAGTGAGGTTGTGGAGAAATAGG + Intergenic
1096003331 12:48147746-48147768 AAGGGGGGTTGGAGAAAAGTAGG + Intergenic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096806265 12:54143016-54143038 AGGAGGGGTTGGAGAGAGGTGGG + Intergenic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1096987725 12:55772480-55772502 CTCTGGGGTTGAAGAGGAGTGGG - Intronic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097221247 12:57452457-57452479 CAGTGAGGGTGGGGAGAGGTGGG + Intronic
1097257441 12:57690227-57690249 GTGTGGGGTTGAGGAGAAGTGGG - Intergenic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098556113 12:71820885-71820907 GGGTGGGGTTGGAGAGATATTGG - Intergenic
1098908494 12:76185864-76185886 AAGTGGGGGTGAAGAGAAGGTGG - Intergenic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100472815 12:94908857-94908879 AAGTGAGGTTGGAGAGAGCTGGG - Intronic
1100497405 12:95138633-95138655 CAGTGTGGTGGGAGAGAAATGGG - Intronic
1100587097 12:95990526-95990548 CAGGAGGCTGGGAGAGAAGTAGG + Exonic
1100815034 12:98378678-98378700 CAGTGTGGGTGAAGTGAAGTGGG - Intergenic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101580659 12:106038585-106038607 CCGTGGAGTTAGAGAGAACTGGG + Intergenic
1101730443 12:107422601-107422623 CAGTGGAGGTGATGAGAAGTTGG + Intronic
1101869592 12:108554004-108554026 CCCTGAGGTTGGAGAGACGTTGG - Intronic
1102392758 12:112562904-112562926 CAGTAGGGATAGGGAGAAGTGGG - Intergenic
1102708528 12:114904923-114904945 TAGTGAGATGGGAGAGAAGTGGG + Intergenic
1103325243 12:120116311-120116333 CTCTGGAGTTGGAGAGACGTGGG - Intronic
1103386131 12:120534182-120534204 CAGTGGGGTTGGGGCGGAGGTGG + Intronic
1103844292 12:123890726-123890748 CACTGGGGACAGAGAGAAGTGGG + Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1105619848 13:22056172-22056194 CCATGGGGGTGGAGAGAAATGGG + Intergenic
1106155536 13:27152011-27152033 CAATGGGGATGCAGAGAAATGGG + Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106506871 13:30378165-30378187 GAGCGGGTTTGGAGAGAAGATGG + Intergenic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1107131507 13:36901308-36901330 CAGTGAGGATGTAGAGAAATTGG - Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108007225 13:45961540-45961562 TAGTGGGGGTGGGGAGATGTGGG + Intronic
1108586609 13:51875582-51875604 CAGTGGGTCTGGAGAGGGGTAGG - Intergenic
1108845892 13:54678231-54678253 CTGAGGGGTTGGAGAGAGGGAGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110441553 13:75532115-75532137 CTTTTGGGGTGGAGAGAAGTGGG + Intronic
1110506919 13:76297774-76297796 CAGAGGGGTTGGACAGCAGGTGG + Intergenic
1111201416 13:84942691-84942713 GAGTGTGGTAGGAAAGAAGTAGG + Intergenic
1111266988 13:85829143-85829165 CAGTGAGGCTGGGGAGATGTTGG + Intergenic
1112461100 13:99604543-99604565 GAGTGGGGCTGGAGATAAATTGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112566800 13:100558836-100558858 GAGAGGGGATGGAGAGAGGTTGG + Intronic
1112904705 13:104402539-104402561 GAGGGGGGTTGAAGAGATGTTGG + Intergenic
1113240980 13:108336632-108336654 CGGGGGTGTTGGAGAGAGGTAGG - Intergenic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1114648155 14:24267098-24267120 CAGTGGGGTGGGTGAGGAGGAGG + Intronic
1114898602 14:27027008-27027030 TAGTGGGGGTGGCGATAAGTTGG - Intergenic
1115091714 14:29584932-29584954 AATTTGGGGTGGAGAGAAGTCGG - Intronic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115397636 14:32926578-32926600 CAGTGGGGTAAGGGGGAAGTGGG + Intergenic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1116619268 14:47177661-47177683 CAGTGGGGAGGGATAGCAGTAGG + Intronic
1116648445 14:47560032-47560054 CAGTGAGGTTGCAGAGAAAAGGG - Intronic
1116803005 14:49463280-49463302 GAGTGAGGTGGGGGAGAAGTGGG - Intergenic
1117108384 14:52422255-52422277 AATTGGAGTTGGAGGGAAGTGGG + Intergenic
1117124991 14:52613483-52613505 TGGAGGGGTTGGGGAGAAGTGGG - Intronic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117840588 14:59856650-59856672 GATTGGGGGTGGAGAGAAGTCGG - Intronic
1117881122 14:60314508-60314530 AAGAGGGGTTGGGGAGAAGGAGG + Intergenic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118065246 14:62183964-62183986 CCTTATGGTTGGAGAGAAGTGGG - Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118480460 14:66159686-66159708 CCCTGGGGTTGGAGAGAACATGG + Intergenic
1118688385 14:68314237-68314259 CAGTGGAGTAGGAGTGAACTGGG - Intronic
1118890646 14:69905657-69905679 TAGTGGGGTTGAAGAAAAGAAGG + Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119691329 14:76675003-76675025 CAGTGGGGTAGAAGAGATGGTGG + Intergenic
1119769374 14:77210874-77210896 TCATGGGGTTGGAGAGAAGGTGG + Intronic
1120769939 14:88368042-88368064 CAGTGAGGTTGTAGAGAAAAAGG - Intergenic
1120898648 14:89556994-89557016 CTGTGGGGTGGGAAAGAACTTGG + Intronic
1121439889 14:93941969-93941991 GAGTGAGGTTGGACAGAAGGTGG + Intronic
1121456342 14:94041106-94041128 CAGTGGGCATGGCAAGAAGTGGG + Intronic
1121829891 14:97042142-97042164 CAGTGGGGTGCCAGAGAAGAAGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122053030 14:99073191-99073213 CAGAGGGGTTAGACAGAACTGGG - Intergenic
1122403765 14:101484238-101484260 CAGGAGGGAGGGAGAGAAGTTGG + Intergenic
1122438204 14:101713002-101713024 CAGTGGGTTGGGAGAGATGACGG - Intergenic
1122631345 14:103109095-103109117 CAACGGGGTTGGGGAGTAGTTGG - Intronic
1123102690 14:105816338-105816360 CAGTGGGCTTGGGAAGGAGTGGG - Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1124957044 15:34366706-34366728 CCCTGGGGTTGGAGAGATGAAGG - Intronic
1124991323 15:34676890-34676912 CAGTGTGGTGGGAGAGCAGTGGG + Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125329142 15:38565015-38565037 CAGGGGAGTTGGAGAGGAGCGGG + Intronic
1126374288 15:47979576-47979598 AAGGGGGGTTGAAGAGGAGTTGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128261112 15:66233687-66233709 GAGTCATGTTGGAGAGAAGTGGG - Intronic
1128650933 15:69413162-69413184 CAGAGGGGTGGGAGACAAGAGGG + Intergenic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1129769090 15:78192354-78192376 CAGAGGTGGTGTAGAGAAGTGGG - Intronic
1129772822 15:78213552-78213574 CAGTGGGGTTGGGCATGAGTGGG + Intronic
1130303953 15:82700355-82700377 CAGTGGCATTGGAGACCAGTGGG - Intronic
1130333760 15:82941575-82941597 CAGTGGGCTTGGAGAGGAAGAGG - Intronic
1130854276 15:87827111-87827133 CAGTGGGGTTGGATGGGAATTGG + Intergenic
1130884002 15:88078347-88078369 AAGTGGGGTTAAAGAAAAGTGGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1131285010 15:91049584-91049606 GACTGGGGCTGGAGAGAAGCGGG + Intergenic
1131366917 15:91849483-91849505 CATTTTGGTAGGAGAGAAGTGGG - Intergenic
1131501862 15:92975523-92975545 CCATGGGATTTGAGAGAAGTGGG + Intronic
1131540611 15:93272060-93272082 CAGCGGGGTTGGAATGAAGCAGG + Intergenic
1131647611 15:94362055-94362077 CACTGGGGTTGGTGAGATGAAGG + Intronic
1132024170 15:98390825-98390847 CAGTGGGGTGGGTGAGTAGTTGG - Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134629810 16:15748508-15748530 CAATGGTGGTGAAGAGAAGTGGG - Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135477747 16:22792428-22792450 GAGTGGGGCAGGAGAGAGGTGGG + Intergenic
1136265083 16:29111500-29111522 GAGTGGGGCTGGACAGAAGGTGG + Intergenic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136409719 16:30069232-30069254 CAGTGGCTGTGGAGAGATGTAGG + Intronic
1136481352 16:30543922-30543944 CATTGGGGTTGGTGAGAGGCTGG + Intronic
1137849045 16:51720360-51720382 CACTGGGGTTTCAGGGAAGTGGG + Intergenic
1137994578 16:53196317-53196339 CATTAGGGTAGGAGAGAGGTAGG - Intronic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138339805 16:56281349-56281371 GAGTGGGGTGGGACAGATGTGGG - Intronic
1138540303 16:57683824-57683846 CAGTGGGGGTGGAGAGCCATAGG + Intronic
1138540479 16:57684534-57684556 TATTGGGGCTGGAGAGAGGTGGG + Intronic
1138989870 16:62378001-62378023 AAGTGGGGTGGGAGAGAGGAGGG - Intergenic
1139023454 16:62782041-62782063 ACGTGGGGTTGGAAAGAGGTGGG + Intergenic
1140867544 16:79077112-79077134 CTTAGGGGTTGGAGAGCAGTGGG - Intronic
1141039204 16:80656801-80656823 CAGTGGGGTGGGAGAGGGGAGGG + Intronic
1141409814 16:83825381-83825403 CACTGGGGTTGCAGTGAAGCAGG + Intergenic
1141447714 16:84072829-84072851 CAGTGGGGTTCAGGAGAAGATGG - Intronic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1142134178 16:88444094-88444116 AAGTGGGGTAGGAGAGAAGTGGG + Intergenic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142591719 17:1009204-1009226 TAGTGGGGATGGACAGCAGTGGG - Intronic
1142599585 17:1047107-1047129 GAGGGGGCTTAGAGAGAAGTGGG + Intronic
1142679179 17:1535535-1535557 AATTGGGGTTGGAGGGGAGTGGG + Intronic
1143023405 17:3928110-3928132 GTGTCGGGCTGGAGAGAAGTGGG - Intronic
1143482189 17:7234217-7234239 CGGTGGGGTTGGGGAGACGAAGG - Exonic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144086403 17:11812885-11812907 CTTTGGGGTAGGAGGGAAGTTGG - Intronic
1144462328 17:15468181-15468203 CAATGGAGTTGGGGAGAAGGAGG - Intronic
1145916328 17:28576166-28576188 CAGTGGGGCTGCAGTGATGTAGG + Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1146696370 17:34911679-34911701 CAGTGTGGCTGGAGAGAGTTGGG + Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146833641 17:36091976-36091998 CAGTGGAGCTGCAGAGCAGTGGG + Intergenic
1146848231 17:36198815-36198837 CAGTGGAGCTGCAGAGCAGTGGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147455609 17:40536388-40536410 CAGGGGGCTTGGAGAGAGGCAGG + Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1148360841 17:47010753-47010775 GAGAGGGATGGGAGAGAAGTAGG + Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1149406552 17:56357583-56357605 CAGTCGTGTTGGAGAGAGGCAGG + Intronic
1149630257 17:58116216-58116238 CAGTGGGGTAGCAGAGAAGTTGG + Intergenic
1149689055 17:58558465-58558487 TAGTGGGGCTAGAGAGAATTTGG - Intronic
1150532604 17:66000201-66000223 CAGTGAGGTTGCAGAGAAAAAGG - Intronic
1152624060 17:81380172-81380194 GAGTGGGGGTGGGGAGTAGTGGG - Intergenic
1153098343 18:1435428-1435450 CAGTGAAGTTGGAAAGAAGTAGG - Intergenic
1153687637 18:7562489-7562511 AAGTGTGGTTTGAGAGAAATGGG - Intergenic
1154234185 18:12587976-12587998 GAGTAGGGTTGGAGAAAAATGGG - Intronic
1154247550 18:12713122-12713144 CAGTGGAGGAGGAAAGAAGTCGG - Intronic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1155530326 18:26760091-26760113 CCTTGGAGTTGGAGAGAAGGGGG + Intergenic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1156918432 18:42488977-42488999 CAATAGGGCTGGAGAGGAGTAGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158858255 18:61565744-61565766 GCTTGGGGTTGGAGAGGAGTAGG - Intergenic
1160009795 18:75097928-75097950 CTGTGGGGTTTGGGAGAGGTTGG + Intergenic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1163480551 19:17553583-17553605 AGGTGGGGTTGGAGGGAAATAGG - Exonic
1164581304 19:29437041-29437063 GAGTGGGGCTGGAGAGATGGAGG + Intergenic
1165782373 19:38441934-38441956 CTTTGGGGTTGGAGGGATGTGGG + Intronic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167569664 19:50279139-50279161 GGGTGGGGTGGGGGAGAAGTGGG - Intronic
1167744867 19:51344858-51344880 CAGTGAGGTGGGTGAGAAGAAGG - Intergenic
1167799240 19:51729626-51729648 AAGAGGGGGAGGAGAGAAGTTGG + Intergenic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925560983 2:5195201-5195223 CAGTGAGATTGGATACAAGTTGG + Intergenic
925631552 2:5899006-5899028 CAGTTGGGGTTAAGAGAAGTTGG - Intergenic
925642988 2:6005318-6005340 CAGTGGGATGGGAGAGACGGTGG - Intergenic
926400402 2:12490698-12490720 CAGAGGAGGAGGAGAGAAGTGGG - Intergenic
926681309 2:15665914-15665936 CACTGGGCTAGGAGAAAAGTGGG + Intergenic
927783090 2:25954890-25954912 CAGTGGCTTTGGAGAGGAGCAGG - Intronic
927993325 2:27463849-27463871 CAGTGTGGTTGGAGACTAATGGG + Intronic
928083307 2:28328702-28328724 CACTGGGGTTGGAGTGACATTGG + Intronic
928338161 2:30416877-30416899 AAGTGGGGTTGGAGAGGATGGGG - Intergenic
928599688 2:32892032-32892054 GAGTGGGGGTGGGGAGATGTTGG + Intergenic
928922374 2:36539136-36539158 CAGAGAGGCTGGGGAGAAGTGGG + Intronic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929257114 2:39824259-39824281 GATTGGGATTGGAGAGATGTTGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930376138 2:50569146-50569168 TAGTGGGGGTTGGGAGAAGTGGG + Intronic
930875780 2:56213997-56214019 CAGTGAGGCTGGAGAGACATTGG + Intronic
931355756 2:61537220-61537242 CCCTGGGGCTGGGGAGAAGTTGG - Intronic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932234916 2:70113166-70113188 CAGTGGGGTGGGAGTGGAGGTGG - Intergenic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932689489 2:73900242-73900264 CAGTGGGGCGGGGCAGAAGTGGG - Intronic
933350026 2:81142083-81142105 GAGAGGGGATGAAGAGAAGTTGG - Intergenic
933559917 2:83876357-83876379 CAGTTTGGTTGGAGAGAGGGAGG + Intergenic
933679216 2:85084307-85084329 GGGTGGGGTGGGAGAAAAGTAGG + Intergenic
934728216 2:96638587-96638609 CGGTGGGGGTGGCGAGAACTGGG - Intronic
934757406 2:96833612-96833634 CTATGGGGTTTTAGAGAAGTGGG + Exonic
934936425 2:98469167-98469189 CAGCTGGGGTGGAGAGCAGTGGG + Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
934981768 2:98849088-98849110 CAGTGGGGCTCAAGAGAAGCTGG + Intronic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937025045 2:118690763-118690785 CAGGGGGATTGAGGAGAAGTTGG - Intergenic
937048841 2:118871609-118871631 CAGAGGAGCTGGAAAGAAGTAGG - Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937769751 2:125706561-125706583 CAGTGAGGCTGAAGAGAAATAGG + Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938866657 2:135428892-135428914 TGGTGGGGTTGAAGAGAAATGGG + Intronic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
939424660 2:142019558-142019580 CAATGGGGAAGGATAGAAGTGGG - Intronic
939733698 2:145817221-145817243 CTGTGGGGTTGGGGAGAGGGGGG - Intergenic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940292005 2:152086391-152086413 CAGTTGTGTGGGAGAGAAATAGG - Intronic
940971568 2:159902330-159902352 CAGTGGTGTTTGAGAGAAAATGG + Intronic
942053395 2:172161859-172161881 CAGTGGGGTGGGACAGACCTGGG - Intergenic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
943582760 2:189703749-189703771 CAGTAGGGTTGGACAAAAATTGG + Intronic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
944877058 2:203972939-203972961 GAGTGGAGTTGGAGAAGAGTGGG - Intergenic
946512219 2:220370379-220370401 CAGTGCAGGTGGTGAGAAGTGGG - Intergenic
947003566 2:225486020-225486042 AATGGGGGTAGGAGAGAAGTGGG - Intronic
947429143 2:230010377-230010399 CAGTGGGGTGGGGGTGAAGGTGG + Intronic
948030647 2:234814710-234814732 CAGTGGGGTGGGACAGGGGTGGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948551600 2:238776244-238776266 CAGTGGGGAAGGGGAGATGTCGG + Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168857432 20:1018584-1018606 CAGTGGGGCTGGAAAAGAGTGGG - Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169826134 20:9770769-9770791 CAGTGGGGTTGAAGAATCGTTGG + Intronic
1170634082 20:18089594-18089616 AAGTAGGGGTGAAGAGAAGTTGG + Intergenic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170881961 20:20304729-20304751 CAGTGAGGGTGTGGAGAAGTGGG + Intronic
1172773499 20:37394729-37394751 CAGAGGGGCTGGAGAGAAAGGGG - Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1172855892 20:38002114-38002136 CAGTGGGGTGGGGTAGAAGTGGG - Intronic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1173915844 20:46708587-46708609 TGGTGAGGTTGGAGAAAAGTAGG - Intergenic
1173926536 20:46785238-46785260 CAGTGGGGTTGCAGCAAAGAGGG - Intergenic
1174530918 20:51213293-51213315 CACTGGGGTTGCTGAGAAGTGGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175180808 20:57145779-57145801 CACTGGGGTAGGAGTGAAGAGGG - Intergenic
1175198504 20:57262934-57262956 CAGTAGGGTTGGAGAGGGTTGGG - Intronic
1176023308 20:62973487-62973509 CAGTGGGCTTGGGGAGAAGCCGG - Intergenic
1177149516 21:17440897-17440919 CTGGGGTGCTGGAGAGAAGTAGG - Intronic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1178289353 21:31353728-31353750 TAGTGAGGTTGGAGAGAGCTGGG - Intronic
1178596858 21:33962161-33962183 GAGTGGAGTTGGAGAGAAACAGG + Intergenic
1179252752 21:39686759-39686781 CAGTGAGATTGGTGAGATGTAGG + Intergenic
1179550549 21:42140939-42140961 CAATGGGGTTGGTGAGGAGGGGG - Intronic
1179994141 21:44966223-44966245 CAGCGGGATTGGAGAGGAGCTGG + Intronic
1180063843 21:45403211-45403233 GAGTGGGGCAGGAGAGAGGTAGG + Intergenic
1180629219 22:17215808-17215830 CATGGGGGATGAAGAGAAGTTGG + Intronic
1180880999 22:19203557-19203579 CAGCGGGGTGGGAGAAAAGCAGG - Intronic
1180966444 22:19790444-19790466 CAGTGAGGTGGGAGAGGAGAAGG - Intronic
1181000809 22:19987057-19987079 CAGACAGGTTGGAGGGAAGTTGG - Intronic
1181430518 22:22878856-22878878 CAGTGGGGTGTGAGATCAGTGGG - Intronic
1181659887 22:24338278-24338300 CAGCGGGGTTTGAGAGCATTGGG + Intronic
1182116219 22:27757961-27757983 TAGTGGGGCAGGAGAAAAGTGGG - Intronic
1182146208 22:27998442-27998464 CAGTGGGGTTGGGGAGGGGAGGG - Intronic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182882747 22:33747544-33747566 CAATGGGCTTGGTGAGGAGTGGG - Intronic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1183023625 22:35047336-35047358 AAGTGGGGTTGTACAGAAGAGGG + Intergenic
1183338071 22:37262321-37262343 GAATGGGGTTGGTGGGAAGTGGG - Intergenic
1183390027 22:37540424-37540446 CTGTGTGTTTGGAGAGCAGTGGG - Intergenic
1183724559 22:39581217-39581239 AAGTGGGGAGGCAGAGAAGTGGG + Intronic
1183739592 22:39662469-39662491 CGGTGGGATAGGACAGAAGTGGG + Intronic
1183832624 22:40426469-40426491 CAGTTGAGTAGGAGAGAAGGAGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184802451 22:46769840-46769862 CTGTGGGGTTGGAGAGGATCGGG + Intronic
949393754 3:3592580-3592602 CAGTGAGGTTGTAGAGAAAAAGG + Intergenic
949949951 3:9220962-9220984 CAGCGGGGTGGGACAGAGGTGGG - Intronic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950119772 3:10474097-10474119 CAGTGGTGTTGGAGAGGTGTGGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
951032227 3:17895383-17895405 CAGTGGGGTAGAACACAAGTGGG - Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
951245586 3:20337774-20337796 CAGTGGACTTGGAAAGAAATGGG + Intergenic
951747978 3:26000213-26000235 TAGTGAGGTTGCAGAGAAATGGG - Intergenic
953279437 3:41539461-41539483 TAGTAGTGTTGGAGAGTAGTAGG - Intronic
953772945 3:45792718-45792740 GTGTGGGGTTGGGGAGAGGTGGG - Intronic
953849485 3:46455071-46455093 CCGTGGGGCTGGTGAGAAGTTGG + Intronic
954672877 3:52299884-52299906 CAGGGAGGGAGGAGAGAAGTGGG + Intergenic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
956112597 3:65884737-65884759 AAGTGGGGATGGAGAGATGGAGG - Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956644000 3:71438884-71438906 CAGTGGGGTTGGGGAGGGCTGGG - Intronic
957705827 3:83782067-83782089 CAGTGGTGTTTTATAGAAGTTGG - Intergenic
957800536 3:85074152-85074174 TAATGTGGCTGGAGAGAAGTGGG - Intronic
958164641 3:89864262-89864284 TAGTAGGTTTGGAAAGAAGTAGG - Intergenic
958495042 3:94834316-94834338 CAGTGAGGTTGCAGAGAAAAGGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
959979382 3:112498194-112498216 CAGTTGGGTAGGACAGATGTTGG + Intronic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
962958512 3:140288665-140288687 CAGTGGTGTTGGTGGGAAGCAGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963215291 3:142739540-142739562 CAGTTGGGTTGGGGAGTAGTAGG + Intronic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963975218 3:151472887-151472909 CAGTGTGGGTGGTGAGAACTTGG - Intergenic
964282309 3:155079979-155080001 CAGTGGGATTCGGGAGAAGTTGG - Intronic
964517544 3:157529039-157529061 AAGGGGGGTTTGAGAGTAGTGGG + Intronic
964751577 3:160058688-160058710 GAGTGGGGTTGGTGGGGAGTGGG + Intergenic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966420920 3:179733282-179733304 CAGCTGGGTGGGAGACAAGTCGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967384627 3:188899327-188899349 CAGGTGTGTTGGGGAGAAGTGGG - Intergenic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
968458993 4:714446-714468 CAGTGGGGTTGTAGCGGTGTGGG - Intronic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
970168985 4:13269975-13269997 CAGTGGGGGAGGAGAAAAGGAGG - Intergenic
970269846 4:14334373-14334395 CAGTGAGGTTGCAGAGAAAAAGG + Intergenic
970897096 4:21117047-21117069 CAAGGGGTTTGGAGAGAATTAGG - Intronic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971360954 4:25937935-25937957 CAGTGAGATTGGAAAGCAGTTGG + Intergenic
971757341 4:30720970-30720992 CAGTGGGGCTGGGAAGAGGTGGG - Exonic
971774598 4:30946471-30946493 CAGTGTGGTGGGAGGGAGGTGGG - Intronic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
972801826 4:42483803-42483825 CAGTTTGGTTGGAAAGATGTGGG - Intronic
973161985 4:47030954-47030976 AAGTGGGGTGGAAGAAAAGTTGG + Intronic
973805622 4:54523440-54523462 TAGAGGGTTTGCAGAGAAGTGGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
975302718 4:72809622-72809644 GAGTGAGGTGGGAGGGAAGTGGG + Intergenic
975731995 4:77346564-77346586 CAGTGGGGTTGGACAACAGGAGG - Intronic
975734875 4:77371434-77371456 CAGAGGGGTTGGACATGAGTCGG - Intronic
975808014 4:78133380-78133402 TAGTGGGGTGGGAGGGAGGTAGG + Intronic
976116215 4:81730391-81730413 CAGTGAGGTTGTAGAGAAAAAGG + Intronic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976928219 4:90529253-90529275 CACTGGGGCTGGAGTGCAGTGGG + Intronic
977845809 4:101765234-101765256 CAGTGAGGTTGCAGAGAAAAGGG - Intronic
977889383 4:102290784-102290806 CTGTGGGGTTGGGGAAAAGTGGG - Intronic
978369405 4:108015561-108015583 CTGTGGGGTAGGAGAGAGGGAGG - Intronic
978417972 4:108498699-108498721 AAGTGGGTTTGGGGAGATGTTGG + Intergenic
979615087 4:122733206-122733228 CAGTGTCGTTGGAGGGACGTGGG + Intronic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980802403 4:137769261-137769283 CAGAGGGGTAGCAGTGAAGTGGG + Intergenic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982156297 4:152524706-152524728 GAGTGGGGTTGTACAGAGGTGGG - Intronic
982310189 4:153976283-153976305 GAATGAGGCTGGAGAGAAGTTGG - Intergenic
982852199 4:160332722-160332744 AGGTGGGGGTGAAGAGAAGTTGG - Intergenic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983907326 4:173197734-173197756 GGCTGTGGTTGGAGAGAAGTGGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984675125 4:182538698-182538720 TAGTGGAGTTGAAGAGAAGTGGG + Intronic
984960149 4:185088957-185088979 CACTGGGGTTGGAGAGTATTGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985614067 5:909057-909079 GGGTGGGATAGGAGAGAAGTGGG - Intronic
985715723 5:1459882-1459904 TAGTGGGGATGCTGAGAAGTGGG - Intronic
987523633 5:19020045-19020067 AAGTGGGGTTAGGGAGAATTTGG - Intergenic
987612766 5:20228606-20228628 GAGAGGGGTTGGTGAGATGTTGG - Intronic
987859730 5:23468963-23468985 CAGAGGCGTTGAAGAGAACTAGG + Intergenic
988137170 5:27188827-27188849 CAGTGGGGCAAGAGAGATGTGGG + Intergenic
988249185 5:28732894-28732916 GAGTGGGGATGGGGAGATGTTGG - Intergenic
988780867 5:34520868-34520890 CATTAGGGTTGGGGAGAAGAGGG - Intergenic
989076598 5:37570145-37570167 CAGTTGGGGTAAAGAGAAGTAGG + Intronic
989125539 5:38049108-38049130 CAGGGGAGTGGGAGAGGAGTGGG + Intergenic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991422607 5:66456370-66456392 GAGTGGGGTTGGGGGGTAGTGGG - Intergenic
991481926 5:67090298-67090320 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991481938 5:67090330-67090352 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
991683649 5:69162366-69162388 CAGTGGGGTTGGAGGGCTGAAGG + Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992127350 5:73655492-73655514 CAGTGGGGTTTGTAAGAAGAGGG + Intronic
992673436 5:79081949-79081971 CAGTGGGGTTGGCCAGGCGTGGG - Intronic
992788316 5:80190923-80190945 AAGTGGGGTTGGAGAAAATGAGG - Intronic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993087837 5:83385769-83385791 CAGTGAGGATGGAGAAAAATTGG + Intergenic
993276366 5:85864842-85864864 TAGGGAGGGTGGAGAGAAGTGGG + Intergenic
994145391 5:96389085-96389107 CAGTGGGGTGGGAGAGGTGGGGG + Intergenic
994921313 5:106047876-106047898 CACTGTGGTTGTAGTGAAGTAGG - Intergenic
995019309 5:107349038-107349060 TAGTGGGGTTAGGGGGAAGTGGG - Intergenic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996381101 5:122863374-122863396 CAGTGGGTTTGGAATGCAGTAGG + Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997296592 5:132772629-132772651 TCGTGGGGTTGGACAGAAGGCGG - Intronic
998007036 5:138663870-138663892 CACTGAGGTAGGAGTGAAGTTGG + Intronic
998104066 5:139457208-139457230 CAGGTGGGGTGGAGAGTAGTGGG - Intronic
998192834 5:140042184-140042206 GGTTGGGGTTGGAGAGAAGAAGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998636260 5:143958268-143958290 TGATGGGGTTGGAGAGAAGGGGG + Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
999750794 5:154627041-154627063 CAGTGGGGTTGTTGAGAACATGG - Intergenic
1000294551 5:159901856-159901878 TAGTGAGGTTGGGGAGAAATTGG + Intergenic
1001332866 5:170774360-170774382 TAGTGGGGTTGGGGGGATGTAGG + Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002510539 5:179713466-179713488 GAGAGGGGTTGAAGACAAGTTGG + Intronic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1002816708 6:687781-687803 CACTGGGATGGGTGAGAAGTTGG + Intronic
1002981359 6:2141935-2141957 GAGCGGGGTCGGAGAGAAGGGGG - Intronic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1004204081 6:13574959-13574981 CAGTGGGCGTGGAGAGGGGTCGG + Intronic
1005390928 6:25332419-25332441 CAGTGAAGGTGTAGAGAAGTGGG + Intronic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1005940226 6:30555373-30555395 CAGAGGGGCTGGAGAGAGTTGGG - Intronic
1006938880 6:37738203-37738225 CAGTGGGGAGGGTGAGAAGGGGG + Intergenic
1007115980 6:39343622-39343644 CAGTGAGGTGGGAGGGGAGTAGG - Intronic
1007192190 6:40028915-40028937 CAGTGAGGGTGGAGAAAAGTAGG + Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008046735 6:46858987-46859009 CAGGGGGGTGGGACAGCAGTGGG - Exonic
1008718435 6:54318487-54318509 TAGTGAGGATAGAGAGAAGTAGG - Intronic
1009268928 6:61593313-61593335 CAGAAGGGTAGGAGAAAAGTTGG + Intergenic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1010246604 6:73665368-73665390 AAGGGGGGATGAAGAGAAGTTGG + Intergenic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1012074394 6:94666410-94666432 CAGGGCGGGTGGGGAGAAGTTGG - Intergenic
1012143790 6:95656141-95656163 AAGTGGGGATGGAGAAAAGGTGG - Intergenic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1014265334 6:119270515-119270537 AAGAGGGGTTGGAGGGAAATGGG - Intronic
1014570027 6:122996898-122996920 CCGCGGGGTTGGAGAAAAGGGGG - Intronic
1015828722 6:137344659-137344681 CAGTGGGGTTGGGGGTATGTTGG + Intergenic
1017043464 6:150325920-150325942 CAGGGGAGGTGGTGAGAAGTGGG + Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017809819 6:157976813-157976835 CAGCGAGGTTGGGGAGAAGAAGG + Intergenic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018923766 6:168193149-168193171 CCGTGGGGTGGGAGAGAGGACGG + Intergenic
1019509829 7:1412299-1412321 CACTGAGGTTGGAGAGGGGTGGG - Intergenic
1019532720 7:1511687-1511709 CACTGCGGGAGGAGAGAAGTGGG - Intergenic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1019805118 7:3117917-3117939 CAGGAGGGTGGGAGAGAAGGTGG - Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020409597 7:7876280-7876302 CAGTGGGATTGAAGAGGAATAGG + Intronic
1020650953 7:10875658-10875680 AGGTGGGGTTGGGGAGATGTTGG - Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021545464 7:21808515-21808537 GAGAGGGGATGCAGAGAAGTTGG - Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1022090002 7:27102004-27102026 GAGTGGGCTGGGAGAGAAGGAGG - Intronic
1022305768 7:29145468-29145490 CACTGGGGTTGCAGTGAAGGTGG + Intronic
1022342920 7:29485888-29485910 CATGGGGGTGGGAGAGAATTTGG - Intronic
1022374139 7:29797688-29797710 CAACAGGCTTGGAGAGAAGTAGG + Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1022638213 7:32157203-32157225 GAGGGGGGTTGAAGAGAAGTTGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1023932087 7:44712253-44712275 CAGAGGTGTTGGAGGGAAATGGG + Intergenic
1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024350193 7:48355644-48355666 CAGTGTGGTAGCAGAGAAGCTGG + Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1024847347 7:53662377-53662399 CTGTGGGGTTAGAGTGAAGGAGG - Intergenic
1025061860 7:55816205-55816227 GATTGGGGAGGGAGAGAAGTGGG + Intronic
1026108481 7:67439516-67439538 CAGTGGGGTTTGACATAATTGGG + Intergenic
1026300566 7:69094224-69094246 CAATGGGCTTGGAAATAAGTTGG - Intergenic
1027846590 7:83385626-83385648 CTATGGGGTGGGACAGAAGTAGG + Intronic
1028057150 7:86260070-86260092 AAGGTGGGTTGGAGAGATGTTGG + Intergenic
1028883050 7:95901549-95901571 CACTTGGGTTGGAGAGGAGGGGG - Intronic
1030054588 7:105572194-105572216 CAGGGGGATTGGGGAGATGTTGG - Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030894468 7:115040077-115040099 CATTTGGGTTGGAGATGAGTGGG - Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1032653760 7:133906026-133906048 CAGTGTGGTTGGGTAGAAATGGG + Intronic
1033025974 7:137772919-137772941 CAATGGGGGTGGAGAGAGGAAGG + Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033652815 7:143355167-143355189 CTGTGGGGTTGGAGAGCACTTGG - Exonic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037456185 8:19066566-19066588 CTGTGGAGTAGAAGAGAAGTTGG - Intronic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038400431 8:27280303-27280325 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1040067886 8:43163111-43163133 CAGTGAGGTGGGAGGGAGGTTGG + Intronic
1040902054 8:52427548-52427570 CATTGGGGTGGGAGATCAGTGGG + Intronic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1042540903 8:69906231-69906253 AAGTGGGTTTGGAGATGAGTCGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043130131 8:76449499-76449521 TAGTGGGGTTGGAGAAGAATTGG - Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044476557 8:92633301-92633323 CATGGGGGTTGGGGAGAGGTTGG - Intergenic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045301403 8:100913827-100913849 CACTGGGGTTGCAGTGAGGTGGG + Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG + Intergenic
1045480232 8:102586104-102586126 GAGTGGGGTTGGGGAGCAGAAGG - Intergenic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047825137 8:128565144-128565166 CCCTGGGGTTGGAGAGAATCTGG + Intergenic
1048008759 8:130440120-130440142 CAATGGAGGTAGAGAGAAGTGGG - Intronic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048505837 8:135020519-135020541 CAGGAGTGTTGGAGGGAAGTGGG - Intergenic
1049070145 8:140349599-140349621 CAGTGGGGTGGGAGAGAGGGAGG + Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049476740 8:142800387-142800409 CAGTGGGGCTGGAGACAGGGGGG - Intergenic
1049609922 8:143550146-143550168 AGGTTGGGCTGGAGAGAAGTGGG - Intergenic
1049640273 8:143712165-143712187 CAGAGGGAGTGCAGAGAAGTGGG - Intronic
1049710931 8:144063002-144063024 CAGTGGGGTAGGAGGCAGGTGGG - Intronic
1050431780 9:5569470-5569492 CAGTGGGTTGAGAGAGAGGTTGG - Intronic
1051417638 9:16859209-16859231 CTGTGAGGTTGTAGAGAAATTGG + Intronic
1052865381 9:33461882-33461904 CAGTGGGGTTGCAGAGATGGGGG - Exonic
1052977712 9:34423756-34423778 CAGTGGGGTTGGAAAAAAGGAGG + Intronic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1054800924 9:69347411-69347433 CAGTTGGGTTTGATAGAAGGGGG - Intronic
1055290775 9:74779829-74779851 CAATGTGGTTGGAGAGGAATGGG + Intronic
1056130511 9:83581882-83581904 CAGAGTGGTTGGGGAGAAATGGG + Intergenic
1056139128 9:83657480-83657502 CAGTGGAGGTGGTAAGAAGTTGG - Intergenic
1056443090 9:86639829-86639851 CAGTGCTCTTAGAGAGAAGTAGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1057919327 9:99083760-99083782 CAGTGGATGTGGTGAGAAGTGGG + Intergenic
1058285001 9:103166664-103166686 CAGTGAGGATGTGGAGAAGTGGG - Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059589408 9:115641884-115641906 CAGTGAGGTTGGAGATCATTGGG - Intergenic
1059975275 9:119709557-119709579 CAGTGTAGTTGGAGTGAATTAGG - Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060702671 9:125772000-125772022 CAGTGGGGTGGGAGGTAGGTAGG + Intronic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061279077 9:129586730-129586752 CAGTGGAGTTGGGTAGGAGTGGG + Intergenic
1061633137 9:131886420-131886442 CAGTGGGGGTAGGGAGAAGTGGG - Intronic
1061964305 9:134004499-134004521 CACTGGTGTTTGAGAGAAGCGGG - Intergenic
1062665353 9:137668101-137668123 CAGTGGGGAGGCAGACAAGTAGG + Intronic
1062694261 9:137865095-137865117 CAGAGGGGTGGGAGAGGAGGTGG + Intronic
1203569061 Un_KI270744v1:115158-115180 AACTGGGGTTGGAGAGTAGCTGG + Intergenic
1185669524 X:1795007-1795029 AAGTGAGGATGGAGAGACGTTGG - Intergenic
1186569807 X:10702783-10702805 CAGTGGGGTTGTATTGGAGTTGG + Intronic
1187184955 X:16975349-16975371 CAGTGAGGTTGCAGAGAAAAAGG - Intronic
1187407834 X:19020080-19020102 CAGAGGGATTGGGGAGATGTTGG + Intronic
1187423909 X:19160384-19160406 CAGTGCAATTGGAGAGAACTAGG - Intergenic
1187454550 X:19429706-19429728 AAGTGTGGATGGAGAGAAGGTGG + Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187718717 X:22130138-22130160 CAATGGGGAGGGAAAGAAGTGGG - Intronic
1187929515 X:24281067-24281089 CCGTGGGGGTGGTGAGAAGCGGG + Intergenic
1188642121 X:32519327-32519349 TGGTGGGGGTGGAGAGTAGTTGG + Intronic
1188821560 X:34781449-34781471 GAGTGGTGTGGGAGAGGAGTTGG + Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189250152 X:39594461-39594483 CAGTGGTGTTGATGAGGAGTGGG + Intergenic
1190080431 X:47352968-47352990 GAAGGGGGTTGGAGAGATGTTGG - Intergenic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190727768 X:53201796-53201818 CAGGAGGGTTGTAGAGAAGCTGG - Intronic
1190897658 X:54637007-54637029 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192491419 X:71579543-71579565 CAGTGGCTGTGGGGAGAAGTGGG + Intronic
1192491455 X:71579676-71579698 GAGTGGGGTAGGGCAGAAGTTGG + Intronic
1193499314 X:82254610-82254632 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1193550379 X:82885084-82885106 TAGTGAGGTTGCAGAGAAGAAGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193698813 X:84739819-84739841 CAGGGTGGTTGGAGAGAGGAGGG - Intergenic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1193741707 X:85225115-85225137 TAGGGGGGTGGGAGAAAAGTAGG + Intergenic
1193753342 X:85375006-85375028 GATTTGGGTTGGAGAGAAGGAGG - Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195635771 X:107114193-107114215 CAGTGAAATTGGAGAGAGGTAGG - Intronic
1195824040 X:108977836-108977858 TAGTGCGGTTGGGGAGAAGTGGG + Intergenic
1196666547 X:118323179-118323201 TAGTGGACTTGGAAAGAAGTTGG - Intergenic
1196903224 X:120407134-120407156 AAGTGGGGATGGATAGAAATGGG - Intergenic
1197400529 X:125983896-125983918 CAGTGAGGTGAGACAGAAGTAGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198009125 X:132532460-132532482 CATTGCTGTTAGAGAGAAGTTGG + Intergenic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1199338734 X:146650532-146650554 CAGTGAAGTTCAAGAGAAGTGGG + Intergenic
1199433763 X:147789671-147789693 GAGTGGGGCTGGACAGAAGCAGG - Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1200278870 X:154759997-154760019 CATTGGGGTGGGAGAGTAGGAGG + Intergenic
1201570927 Y:15413598-15413620 CAGTAGGGTGAGAGAGAAGAAGG + Intergenic
1202063177 Y:20909807-20909829 TGGTGGGTTTGGAGAGAAGGGGG + Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic
1202370231 Y:24191255-24191277 CAGTGGTGCTGCAGAGAAATTGG + Intergenic
1202500553 Y:25478862-25478884 CAGTGGTGCTGCAGAGAAATTGG - Intergenic