ID: 1082802939

View in Genome Browser
Species Human (GRCh38)
Location 11:57427445-57427467
Sequence CAGACAGCACATGAGGGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082802930_1082802939 18 Left 1082802930 11:57427404-57427426 CCACCTAGGGAAAATGTCACACC 0: 1
1: 0
2: 2
3: 9
4: 113
Right 1082802939 11:57427445-57427467 CAGACAGCACATGAGGGCATAGG 0: 1
1: 0
2: 1
3: 15
4: 178
1082802929_1082802939 19 Left 1082802929 11:57427403-57427425 CCCACCTAGGGAAAATGTCACAC 0: 1
1: 0
2: 2
3: 11
4: 106
Right 1082802939 11:57427445-57427467 CAGACAGCACATGAGGGCATAGG 0: 1
1: 0
2: 1
3: 15
4: 178
1082802931_1082802939 15 Left 1082802931 11:57427407-57427429 CCTAGGGAAAATGTCACACCCAG 0: 1
1: 0
2: 0
3: 13
4: 202
Right 1082802939 11:57427445-57427467 CAGACAGCACATGAGGGCATAGG 0: 1
1: 0
2: 1
3: 15
4: 178
1082802934_1082802939 -4 Left 1082802934 11:57427426-57427448 CCAGCACCCAGAGGACACACAGA 0: 1
1: 1
2: 5
3: 36
4: 370
Right 1082802939 11:57427445-57427467 CAGACAGCACATGAGGGCATAGG 0: 1
1: 0
2: 1
3: 15
4: 178
1082802935_1082802939 -10 Left 1082802935 11:57427432-57427454 CCCAGAGGACACACAGACAGCAC 0: 1
1: 0
2: 2
3: 23
4: 254
Right 1082802939 11:57427445-57427467 CAGACAGCACATGAGGGCATAGG 0: 1
1: 0
2: 1
3: 15
4: 178
1082802933_1082802939 -3 Left 1082802933 11:57427425-57427447 CCCAGCACCCAGAGGACACACAG 0: 1
1: 0
2: 2
3: 35
4: 401
Right 1082802939 11:57427445-57427467 CAGACAGCACATGAGGGCATAGG 0: 1
1: 0
2: 1
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082802939 Original CRISPR CAGACAGCACATGAGGGCAT AGG Intronic
900354861 1:2255915-2255937 CAGACAGGAAATGAGGTCACTGG - Intronic
900709886 1:4107074-4107096 CAGAAAGGACATGAGGGAAGAGG + Intergenic
900789826 1:4672584-4672606 CAGACAGCTCAGGAGTGCAATGG - Intronic
900824323 1:4913921-4913943 AAGAGAGCACATGAGGACAGAGG - Intergenic
901376959 1:8846406-8846428 CAGACAGCACTTGAGACCTTGGG - Intergenic
901736588 1:11316449-11316471 CAGACAGGATGTCAGGGCATGGG + Intergenic
902114523 1:14110237-14110259 CTTGCAGAACATGAGGGCATGGG + Intergenic
902614613 1:17617012-17617034 CACGCAGCAGATGAGGGAATAGG + Intronic
902865858 1:19278330-19278352 CAGACAGATCATGAGGTCAGGGG + Intergenic
904935315 1:34126027-34126049 CAGACATCACTGCAGGGCATGGG + Intronic
905391544 1:37638999-37639021 AAGAAAGCACAGCAGGGCATGGG - Intergenic
906180298 1:43812135-43812157 CTGACAGCTCATGAGGGCTGTGG - Intronic
907931342 1:59003630-59003652 TACACAGCACCTGAGGGCCTGGG + Intergenic
917689844 1:177457502-177457524 CAAAAAGGACAAGAGGGCATAGG - Intergenic
921258758 1:213366573-213366595 CAGACAACACATGAATGAATGGG + Intergenic
921613570 1:217240449-217240471 CTGACACCAAATGAGGACATTGG - Intergenic
922719079 1:227891172-227891194 CAGACTGCACAGGAGGGGATGGG + Intergenic
1063503457 10:6575541-6575563 CACACAGCACCTGAGGGACTAGG - Intronic
1066166202 10:32790425-32790447 CAGACTGCACCTGGGGCCATTGG + Intronic
1069510953 10:69042203-69042225 CAGACTGCACATGAATGCTTAGG + Intergenic
1069800612 10:71079404-71079426 CTGATAGCACATGAGGGTTTGGG - Intergenic
1070208094 10:74284622-74284644 CCAACAGCACATGAGGGATTGGG + Intronic
1071439590 10:85678543-85678565 CAGAGACCACATGAGGGGATGGG - Intronic
1073630330 10:105141753-105141775 CACACAGCAGCAGAGGGCATGGG + Intronic
1073758012 10:106601776-106601798 CATACAGCACAAGAGGGAAAAGG + Intronic
1074274997 10:111992721-111992743 GAGACAGCCCATGTGGGCTTAGG - Intergenic
1075305465 10:121363856-121363878 CAGACAGCATAAGATGGAATGGG + Intergenic
1075885293 10:125895326-125895348 CAGACAGTACTTGAGGGAAATGG - Intronic
1078465384 11:11546288-11546310 CAGCCAGGACCTGAGGCCATCGG + Intronic
1082802939 11:57427445-57427467 CAGACAGCACATGAGGGCATAGG + Intronic
1090370871 11:126251563-126251585 CATACAGAATATGAGGGCGTAGG - Intronic
1090657417 11:128856526-128856548 GGGACAGCACATCTGGGCATAGG + Intronic
1092248491 12:6877538-6877560 GAGACAGCACATGTGGGGACTGG + Intronic
1093731823 12:22573739-22573761 CAGGCAGAACATGAGGTCAGGGG - Intergenic
1096265730 12:50121124-50121146 CAGTCTGCACATGAGTGTATGGG - Intergenic
1098025623 12:66198377-66198399 AAGACAACACAAGAGGGCAGAGG - Intronic
1101806607 12:108069609-108069631 CAGAGAACAGATGAGGTCATGGG - Intergenic
1102740596 12:115204049-115204071 CAGAGAGAAAATGAAGGCATGGG - Intergenic
1103360084 12:120348197-120348219 CAGACAGCAAACAAGGGGATAGG - Intronic
1103869732 12:124082808-124082830 CAGACAGCACATTAAGGAGTGGG + Intronic
1107830054 13:44367119-44367141 CAGACAGGACATGGGGACAAAGG - Intergenic
1112197226 13:97237874-97237896 CAGGCAGGTCATGAAGGCATGGG + Intronic
1112209116 13:97356759-97356781 CAGCGAGCACATGATGGCAGTGG - Intronic
1113676529 13:112210760-112210782 CAGACAGCACGCCTGGGCATGGG + Intergenic
1114039614 14:18664706-18664728 CAGACAGCCCATTAGAACATTGG - Intergenic
1114044655 14:18863258-18863280 CAGACAGCCCATTAGAACATTGG - Intergenic
1114119568 14:19656267-19656289 CAGACAGCCCATTAGAACATTGG + Intergenic
1117338819 14:54776803-54776825 GAGATAGCACAAGAGGGCTTTGG + Intronic
1119316187 14:73697142-73697164 CAGTAAGCAGATGAGGTCATAGG + Exonic
1119705157 14:76778765-76778787 CAGACAGCACAGGCGGGCCAGGG + Intronic
1122337643 14:101004456-101004478 CAGGCAGCACACAAGGGCAGGGG - Intergenic
1202872763 14_GL000225v1_random:178601-178623 CAGACAGTACTTGAGGGAAATGG + Intergenic
1129959143 15:79667450-79667472 CATACAGCAGATATGGGCATTGG - Intergenic
1131791667 15:95972236-95972258 CAGACAGTGCATGATTGCATTGG - Intergenic
1138343275 16:56304823-56304845 CAGACTGCACGTGTAGGCATGGG - Intronic
1140558165 16:75945651-75945673 CAGCCAGCACATTATTGCATAGG + Intergenic
1140957030 16:79875380-79875402 CAGTCAACACAGGAGAGCATGGG - Intergenic
1141085169 16:81088907-81088929 CAAACATTACATGATGGCATCGG - Intronic
1141766865 16:86064579-86064601 CAGACAGTGCAAGAGGGCCTGGG - Intergenic
1142145814 16:88492558-88492580 CAGCCAGCAGATGAGGGCCCTGG - Intronic
1142264730 16:89058471-89058493 CAGACAGCCCCTGGGGGCCTGGG - Intergenic
1143842334 17:9742845-9742867 GGGACAGCACATGAGAGAATGGG - Intergenic
1144159737 17:12546059-12546081 AAGTCAGCAGATGAGGGCGTAGG - Intergenic
1146680356 17:34802930-34802952 CAGACAGGAGATGAAGCCATGGG - Intergenic
1147576394 17:41602228-41602250 CAGACAGCACATCAGAGGAGGGG + Intergenic
1148237266 17:45977163-45977185 CAGGCAGCTGCTGAGGGCATGGG - Intronic
1148661380 17:49336248-49336270 CAGACAGATCATGAGGTCAGGGG - Intronic
1148849142 17:50546265-50546287 CAGGCAGTAGATGAGGGCAGAGG - Intronic
1151234900 17:72712892-72712914 AAGACATGACATGAGGGCATGGG + Intronic
1152514667 17:80816339-80816361 CAGAGAGCAGCTGAGGGCCTGGG + Intronic
1152551859 17:81034327-81034349 CAGACAGCGCTTGGGGGCTTGGG - Intergenic
1153618736 18:6956580-6956602 CAGTCAGCAAAGGAGGGCCTAGG - Intronic
1154371106 18:13763953-13763975 AAGACAGCACTTGAGTGCACTGG + Exonic
1157334557 18:46728571-46728593 CAGTCAGCACATGGGGTCCTGGG - Intronic
1158071871 18:53480044-53480066 TAGACAGAAGATGAGGCCATAGG - Intronic
1158288425 18:55911487-55911509 CAGACAACACATGATCTCATTGG - Intergenic
1159810294 18:73011159-73011181 CAGACAGCAAATGAGATCAGTGG + Intergenic
1159859686 18:73632515-73632537 ATGACAGCAAATGAGGGCAGAGG - Intergenic
1160721339 19:598186-598208 TAGACAGGACATGAGGGCTCAGG - Intronic
1161230523 19:3172705-3172727 CAGCCATCCCATGAGGGCACAGG - Intronic
1161230604 19:3173070-3173092 CAGGCATCCCATGAGGGCACAGG - Intronic
1161230666 19:3173340-3173362 CAGGCATCCCATGAGGGCACAGG - Intronic
1161230694 19:3173473-3173495 CAGGCATCCCATGAGGGCACAGG - Intronic
1161230699 19:3173492-3173514 CAGGCATCCCATGAGGGCACAGG - Intronic
1161230835 19:3174106-3174128 CAGGCATCCCATGAGGGCACAGG - Intronic
1161231164 19:3175547-3175569 CAGGCATCCCATGAGGGCACAGG - Intronic
1161231205 19:3175721-3175743 CAGGCATCCCATGAGGGCACAGG - Intronic
1161231233 19:3175837-3175859 CAGGCATCCCATGAGGGCACAGG - Intronic
1164258356 19:23548851-23548873 CAGGCAGAACATGAGGTCAAGGG + Intronic
1164436143 19:28231451-28231473 CAGACAGGACAAGAGGGCAAGGG + Intergenic
1164536625 19:29090658-29090680 CAGAGAGGACACGAGGCCATGGG + Intergenic
1165350645 19:35273295-35273317 CAGACAGCAAAGGAGGCCAGTGG - Intronic
1166395436 19:42436295-42436317 AAAACAGCACATGAGAACATTGG - Intronic
1167062925 19:47162051-47162073 CAGTAAGCACATGTGGCCATTGG + Intronic
1168153771 19:54462359-54462381 CACACAGCACATGCGGGCCCAGG + Exonic
1168288446 19:55345854-55345876 CAGGCAGCTCAGGAGGGGATGGG + Intronic
1168560359 19:57376878-57376900 CAGCCTGTACATGAGGGCACTGG + Intronic
925463170 2:4082710-4082732 CAGAAAGCACATGGGGGTGTGGG - Intergenic
926691407 2:15736734-15736756 AAGACAGCAGAAGAGGGCAGAGG + Intronic
927147002 2:20172712-20172734 CAAACAGCACATGGGGCCCTTGG - Intergenic
927304661 2:21556713-21556735 CAGAAACCACATGAGAGCATTGG + Intergenic
929479340 2:42289406-42289428 CAGATAGAAAATGAGGCCATGGG - Intronic
930002298 2:46869599-46869621 CAGACAGCAGATGAGTGAATTGG - Intergenic
932307219 2:70712700-70712722 CAGATTGCAGCTGAGGGCATGGG + Intronic
934569102 2:95357421-95357443 CTGACAGTCCATGAGGGCTTGGG - Intronic
935832266 2:107012427-107012449 CAGACAGCAAATGATGTCCTTGG - Intergenic
936525741 2:113240443-113240465 CCTACAGCAAATGACGGCATGGG + Intronic
938263481 2:129910952-129910974 CAGACACCACATGCGGGCAAAGG - Intergenic
938270993 2:129971215-129971237 CAGACAGCCCATTAGAACATTGG + Intergenic
938489857 2:131755730-131755752 CAGAAAGCCCATGAGGGGAAGGG + Intronic
943462814 2:188190369-188190391 AATACAGCACATAAGGGCAATGG - Intergenic
1171417065 20:24989462-24989484 CACACAGGACATTAGGGCCTTGG + Intronic
1171448203 20:25219314-25219336 CAGACAGCACAGGAGGGCTGTGG + Intronic
1172141760 20:32727319-32727341 CAGACAGATCATGAGGTCAAGGG + Intronic
1172948881 20:38709362-38709384 CAGTCAGAACATGGGGGGATGGG + Intergenic
1173744633 20:45426860-45426882 AAGACAGAAGATGAGGGCAGTGG - Intergenic
1174547290 20:51334868-51334890 TAGACAGGACATGAGGGCTGAGG + Intergenic
1179816312 21:43908543-43908565 TAGACAGAAGGTGAGGGCATGGG + Intronic
1180285341 22:10740899-10740921 CAGACAGTACTTGAGGGAAATGG - Intergenic
1180463179 22:15585815-15585837 CAGACAGCCCATTAGAACATTGG - Intergenic
1181317039 22:21977677-21977699 CACACAGCAGATGAGGGCATGGG + Intronic
1182076586 22:27499324-27499346 CACACAGGACATGAGCACATGGG + Intergenic
949772570 3:7595002-7595024 TAGAAAGCACAAGAGGACATAGG - Intronic
951518791 3:23591593-23591615 CAGACAGTACATAAATGCATTGG + Exonic
952174744 3:30849460-30849482 CAGACAGTAGATAAGCGCATAGG - Intronic
952843005 3:37664303-37664325 CAGACAGCACATGGGGAGAATGG - Intronic
955337991 3:58102925-58102947 GAGACAGCAGATGTGGGGATGGG + Intronic
958641418 3:96812937-96812959 CAGAAAGCACAGGAGGGAAATGG - Intergenic
962345004 3:134612240-134612262 CTGGGAGCACTTGAGGGCATGGG + Intronic
963758371 3:149259420-149259442 TGGACAGCACATGTGGGCATTGG - Intergenic
963845939 3:150158311-150158333 CAAACATCAGATGAGGTCATGGG - Intergenic
964055175 3:152446668-152446690 CAGCGAGCACATGATGGCAATGG - Intronic
964821487 3:160775264-160775286 CACACAGCAAAGGAGAGCATGGG - Intronic
968518717 4:1025705-1025727 CAGGCAGCACATCTGCGCATGGG - Exonic
968671582 4:1855285-1855307 CAGACAGCACCTGAGGCTAGGGG + Intronic
968962048 4:3750600-3750622 CAGACGGCCCACGAGGGCACAGG + Intergenic
970102467 4:12540600-12540622 CAGACAGATCATGAGGTCAGGGG - Intergenic
979306666 4:119153123-119153145 CAGAAGGCACCTGAGAGCATTGG - Intronic
980732414 4:136840019-136840041 CAGACAGCACTGCAGGGGATGGG + Intergenic
981074424 4:140577211-140577233 CAGACAAGAGACGAGGGCATGGG + Intergenic
983003269 4:162447402-162447424 AATACAGCACATTATGGCATAGG + Intergenic
983095686 4:163558632-163558654 CAGAGAGCACATGAGGGGTGTGG + Intronic
995190111 5:109310762-109310784 CTGAGAGCACATGAGGATATCGG - Intergenic
996203932 5:120707616-120707638 CAGACAGCACATGAGTCTCTAGG + Intergenic
1001304575 5:170562354-170562376 CAGAGACCACATGACTGCATGGG + Intronic
1004846208 6:19645389-19645411 CATAGAGCACATGATGGCCTGGG - Intergenic
1008385351 6:50883077-50883099 CAGACAGCACACGTGTGCAATGG + Intergenic
1010585807 6:77657773-77657795 CAGAGAGCATATAATGGCATAGG - Intergenic
1015978450 6:138815084-138815106 CAGACATAACATGAGGGAAGGGG - Intronic
1016671248 6:146711379-146711401 AAGACAGCAAAGGAGTGCATGGG - Intronic
1019047371 6:169159434-169159456 CTGTCAGCAGATGAGGCCATGGG + Intergenic
1019093053 6:169555995-169556017 CAGGGGTCACATGAGGGCATGGG - Intronic
1019931652 7:4227239-4227261 CAAGCAGCACATGAGGGGACCGG - Intronic
1023515460 7:40997089-40997111 CACAAACCACATGAGGGCTTGGG - Intergenic
1023888913 7:44379072-44379094 CAGACAGCTCATGAAGGTAAGGG + Intergenic
1024060109 7:45691011-45691033 CAGACAGCAGATTTGGGCCTTGG + Intronic
1024451228 7:49545657-49545679 CAGATAGAACATGAGGGCCCAGG + Intergenic
1024570872 7:50722076-50722098 GAGACAGGAGAGGAGGGCATAGG - Intronic
1028405642 7:90470839-90470861 CAAACAGCACCTGAAAGCATAGG + Intronic
1033808300 7:144979280-144979302 TAAACAGCACATGAGGGAATTGG - Intergenic
1036659800 8:10700587-10700609 CAGAGACCAGATGATGGCATGGG - Exonic
1037814181 8:22103200-22103222 CACACAGCACATGAGGGTCTGGG - Exonic
1038245329 8:25849634-25849656 CAGACAGCAAAAGAGCACATTGG - Intronic
1039585857 8:38706435-38706457 CAGAGAGCAAATGTGTGCATAGG - Intergenic
1040609794 8:48972842-48972864 GAGACAGCCCATGAAGGCTTGGG - Intergenic
1040874540 8:52137394-52137416 CTGACTGCACATGAGGTCATTGG + Intronic
1042947755 8:74172021-74172043 CAGAGAAGAGATGAGGGCATAGG + Intergenic
1044320175 8:90792259-90792281 CAGACAACATTTGAGTGCATAGG + Intronic
1046431771 8:114136046-114136068 AAGACAACACATGTAGGCATTGG + Intergenic
1046620556 8:116525232-116525254 CAGATAGCACATGTAGGCTTGGG - Intergenic
1046903933 8:119552740-119552762 CAGAAAGCAAATCAGGGCTTGGG + Intergenic
1051347103 9:16162127-16162149 CAGACACCACATGAAGCCATTGG + Intergenic
1052062700 9:23980370-23980392 CAGACAGAAAATAAGGACATTGG + Intergenic
1053167159 9:35853078-35853100 CAGACAGCACTCCAGGGCCTGGG - Intronic
1055234972 9:74110012-74110034 CAGACAGCATCACAGGGCATAGG - Intergenic
1057049653 9:91914110-91914132 CAGCAAGCACACGGGGGCATTGG - Intronic
1058319950 9:103616266-103616288 CAGACAGCAGCTGGGGCCATGGG + Intergenic
1058703941 9:107623665-107623687 TAGACAGCACAGGAGGGACTGGG - Intergenic
1058710367 9:107673771-107673793 CTGAGAGCAAATGAGTGCATGGG + Intergenic
1059367324 9:113796873-113796895 CAGCCAGCCCAGGAGGGAATGGG + Intergenic
1059685316 9:116629482-116629504 CAGACAACACAGTAGGGCAGAGG + Intronic
1061459930 9:130729379-130729401 CTGAGAGAAGATGAGGGCATGGG - Intronic
1061549110 9:131322705-131322727 CAGAAAGCAGATTAGGGCCTGGG - Intergenic
1061750089 9:132771113-132771135 CACACAGCACATCATGGCAGTGG - Intronic
1061930700 9:133831670-133831692 CAGTCAGCACAGGAGGGCTCCGG - Intronic
1203785004 EBV:122695-122717 GAGGCCGCACATGTGGGCATTGG + Intergenic
1203731698 Un_GL000216v2:97952-97974 CAGACAGTACTTGAGGGAAATGG - Intergenic
1187049834 X:15684877-15684899 TAAAAAGCACATGAGGGTATAGG + Intergenic
1189245004 X:39556665-39556687 GAAAGAGCACATGAGGGCATTGG + Intergenic
1192050647 X:67721144-67721166 CAGCCAGCATATGAGGGAATGGG + Intronic
1195981527 X:110583277-110583299 GAGAAAGCAAATCAGGGCATGGG - Intergenic
1198267064 X:135019657-135019679 GGGACAGCACATGATGGAATGGG + Intergenic
1199076639 X:143533395-143533417 CAGTGAGCACATGAGGGTAGAGG - Intergenic
1200068341 X:153515635-153515657 CAGGCACCACAGGAGGGCAGAGG - Intergenic
1200326183 X:155242121-155242143 CAGACTGCACAAAAGGACATAGG + Intergenic