ID: 1082803242

View in Genome Browser
Species Human (GRCh38)
Location 11:57429757-57429779
Sequence CCCCTCAAAGCAATGTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082803242_1082803246 -3 Left 1082803242 11:57429757-57429779 CCATGAGACATTGCTTTGAGGGG No data
Right 1082803246 11:57429777-57429799 GGGAAGAGGGAGCATAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082803242 Original CRISPR CCCCTCAAAGCAATGTCTCA TGG (reversed) Intergenic
No off target data available for this crispr