ID: 1082804418

View in Genome Browser
Species Human (GRCh38)
Location 11:57438499-57438521
Sequence TGAGGGTGGAGCATACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082804418_1082804433 30 Left 1082804418 11:57438499-57438521 CCTTCCTGTATGCTCCACCCTCA No data
Right 1082804433 11:57438552-57438574 ACTGCAGCTTGGGCTGGTTGTGG No data
1082804418_1082804427 19 Left 1082804418 11:57438499-57438521 CCTTCCTGTATGCTCCACCCTCA No data
Right 1082804427 11:57438541-57438563 GGCCTCCCTACACTGCAGCTTGG No data
1082804418_1082804425 -2 Left 1082804418 11:57438499-57438521 CCTTCCTGTATGCTCCACCCTCA No data
Right 1082804425 11:57438520-57438542 CAACCGTGGAGCAGCTGGACAGG No data
1082804418_1082804431 24 Left 1082804418 11:57438499-57438521 CCTTCCTGTATGCTCCACCCTCA No data
Right 1082804431 11:57438546-57438568 CCCTACACTGCAGCTTGGGCTGG No data
1082804418_1082804428 20 Left 1082804418 11:57438499-57438521 CCTTCCTGTATGCTCCACCCTCA No data
Right 1082804428 11:57438542-57438564 GCCTCCCTACACTGCAGCTTGGG No data
1082804418_1082804422 -7 Left 1082804418 11:57438499-57438521 CCTTCCTGTATGCTCCACCCTCA No data
Right 1082804422 11:57438515-57438537 ACCCTCAACCGTGGAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082804418 Original CRISPR TGAGGGTGGAGCATACAGGA AGG (reversed) Intergenic
No off target data available for this crispr