ID: 1082804426

View in Genome Browser
Species Human (GRCh38)
Location 11:57438523-57438545
Sequence AGGCCTGTCCAGCTGCTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082804426_1082804431 0 Left 1082804426 11:57438523-57438545 CCGTGGAGCAGCTGGACAGGCCT No data
Right 1082804431 11:57438546-57438568 CCCTACACTGCAGCTTGGGCTGG No data
1082804426_1082804434 10 Left 1082804426 11:57438523-57438545 CCGTGGAGCAGCTGGACAGGCCT No data
Right 1082804434 11:57438556-57438578 CAGCTTGGGCTGGTTGTGGCTGG No data
1082804426_1082804433 6 Left 1082804426 11:57438523-57438545 CCGTGGAGCAGCTGGACAGGCCT No data
Right 1082804433 11:57438552-57438574 ACTGCAGCTTGGGCTGGTTGTGG No data
1082804426_1082804427 -5 Left 1082804426 11:57438523-57438545 CCGTGGAGCAGCTGGACAGGCCT No data
Right 1082804427 11:57438541-57438563 GGCCTCCCTACACTGCAGCTTGG No data
1082804426_1082804428 -4 Left 1082804426 11:57438523-57438545 CCGTGGAGCAGCTGGACAGGCCT No data
Right 1082804428 11:57438542-57438564 GCCTCCCTACACTGCAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082804426 Original CRISPR AGGCCTGTCCAGCTGCTCCA CGG (reversed) Intergenic
No off target data available for this crispr