ID: 1082804431

View in Genome Browser
Species Human (GRCh38)
Location 11:57438546-57438568
Sequence CCCTACACTGCAGCTTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082804424_1082804431 6 Left 1082804424 11:57438517-57438539 CCTCAACCGTGGAGCAGCTGGAC No data
Right 1082804431 11:57438546-57438568 CCCTACACTGCAGCTTGGGCTGG No data
1082804423_1082804431 7 Left 1082804423 11:57438516-57438538 CCCTCAACCGTGGAGCAGCTGGA No data
Right 1082804431 11:57438546-57438568 CCCTACACTGCAGCTTGGGCTGG No data
1082804426_1082804431 0 Left 1082804426 11:57438523-57438545 CCGTGGAGCAGCTGGACAGGCCT No data
Right 1082804431 11:57438546-57438568 CCCTACACTGCAGCTTGGGCTGG No data
1082804421_1082804431 10 Left 1082804421 11:57438513-57438535 CCACCCTCAACCGTGGAGCAGCT No data
Right 1082804431 11:57438546-57438568 CCCTACACTGCAGCTTGGGCTGG No data
1082804419_1082804431 20 Left 1082804419 11:57438503-57438525 CCTGTATGCTCCACCCTCAACCG No data
Right 1082804431 11:57438546-57438568 CCCTACACTGCAGCTTGGGCTGG No data
1082804418_1082804431 24 Left 1082804418 11:57438499-57438521 CCTTCCTGTATGCTCCACCCTCA No data
Right 1082804431 11:57438546-57438568 CCCTACACTGCAGCTTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082804431 Original CRISPR CCCTACACTGCAGCTTGGGC TGG Intergenic
No off target data available for this crispr