ID: 1082805336

View in Genome Browser
Species Human (GRCh38)
Location 11:57445650-57445672
Sequence TAATTTATGAAACAACTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082805336_1082805341 30 Left 1082805336 11:57445650-57445672 CCCAGTAGTTGTTTCATAAATTA No data
Right 1082805341 11:57445703-57445725 TGCCTACAATCCCAGCATTTTGG No data
1082805336_1082805339 3 Left 1082805336 11:57445650-57445672 CCCAGTAGTTGTTTCATAAATTA No data
Right 1082805339 11:57445676-57445698 AACAGATGAGCCAGGAGCAGTGG No data
1082805336_1082805338 -5 Left 1082805336 11:57445650-57445672 CCCAGTAGTTGTTTCATAAATTA No data
Right 1082805338 11:57445668-57445690 AATTATTAAACAGATGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082805336 Original CRISPR TAATTTATGAAACAACTACT GGG (reversed) Intergenic