ID: 1082805337

View in Genome Browser
Species Human (GRCh38)
Location 11:57445651-57445673
Sequence ATAATTTATGAAACAACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082805337_1082805341 29 Left 1082805337 11:57445651-57445673 CCAGTAGTTGTTTCATAAATTAT No data
Right 1082805341 11:57445703-57445725 TGCCTACAATCCCAGCATTTTGG No data
1082805337_1082805339 2 Left 1082805337 11:57445651-57445673 CCAGTAGTTGTTTCATAAATTAT No data
Right 1082805339 11:57445676-57445698 AACAGATGAGCCAGGAGCAGTGG No data
1082805337_1082805342 30 Left 1082805337 11:57445651-57445673 CCAGTAGTTGTTTCATAAATTAT No data
Right 1082805342 11:57445704-57445726 GCCTACAATCCCAGCATTTTGGG No data
1082805337_1082805338 -6 Left 1082805337 11:57445651-57445673 CCAGTAGTTGTTTCATAAATTAT No data
Right 1082805338 11:57445668-57445690 AATTATTAAACAGATGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082805337 Original CRISPR ATAATTTATGAAACAACTAC TGG (reversed) Intergenic