ID: 1082805338

View in Genome Browser
Species Human (GRCh38)
Location 11:57445668-57445690
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082805329_1082805338 20 Left 1082805329 11:57445625-57445647 CCAGCCCCTGGCCCCGTGCTCAG No data
Right 1082805338 11:57445668-57445690 AATTATTAAACAGATGAGCCAGG No data
1082805330_1082805338 16 Left 1082805330 11:57445629-57445651 CCCCTGGCCCCGTGCTCAGCACC No data
Right 1082805338 11:57445668-57445690 AATTATTAAACAGATGAGCCAGG No data
1082805335_1082805338 7 Left 1082805335 11:57445638-57445660 CCGTGCTCAGCACCCAGTAGTTG No data
Right 1082805338 11:57445668-57445690 AATTATTAAACAGATGAGCCAGG No data
1082805337_1082805338 -6 Left 1082805337 11:57445651-57445673 CCAGTAGTTGTTTCATAAATTAT No data
Right 1082805338 11:57445668-57445690 AATTATTAAACAGATGAGCCAGG No data
1082805333_1082805338 9 Left 1082805333 11:57445636-57445658 CCCCGTGCTCAGCACCCAGTAGT No data
Right 1082805338 11:57445668-57445690 AATTATTAAACAGATGAGCCAGG No data
1082805334_1082805338 8 Left 1082805334 11:57445637-57445659 CCCGTGCTCAGCACCCAGTAGTT No data
Right 1082805338 11:57445668-57445690 AATTATTAAACAGATGAGCCAGG No data
1082805332_1082805338 14 Left 1082805332 11:57445631-57445653 CCTGGCCCCGTGCTCAGCACCCA No data
Right 1082805338 11:57445668-57445690 AATTATTAAACAGATGAGCCAGG No data
1082805336_1082805338 -5 Left 1082805336 11:57445650-57445672 CCCAGTAGTTGTTTCATAAATTA No data
Right 1082805338 11:57445668-57445690 AATTATTAAACAGATGAGCCAGG No data
1082805331_1082805338 15 Left 1082805331 11:57445630-57445652 CCCTGGCCCCGTGCTCAGCACCC No data
Right 1082805338 11:57445668-57445690 AATTATTAAACAGATGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082805338 Original CRISPR AATTATTAAACAGATGAGCC AGG Intergenic