ID: 1082805340

View in Genome Browser
Species Human (GRCh38)
Location 11:57445686-57445708
Sequence TAGGCATGAGCCACTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082805340_1082805342 -5 Left 1082805340 11:57445686-57445708 CCAGGAGCAGTGGCTCATGCCTA No data
Right 1082805342 11:57445704-57445726 GCCTACAATCCCAGCATTTTGGG No data
1082805340_1082805346 4 Left 1082805340 11:57445686-57445708 CCAGGAGCAGTGGCTCATGCCTA No data
Right 1082805346 11:57445713-57445735 CCCAGCATTTTGGGAGGCAAAGG No data
1082805340_1082805341 -6 Left 1082805340 11:57445686-57445708 CCAGGAGCAGTGGCTCATGCCTA No data
Right 1082805341 11:57445703-57445725 TGCCTACAATCCCAGCATTTTGG No data
1082805340_1082805344 -2 Left 1082805340 11:57445686-57445708 CCAGGAGCAGTGGCTCATGCCTA No data
Right 1082805344 11:57445707-57445729 TACAATCCCAGCATTTTGGGAGG No data
1082805340_1082805349 27 Left 1082805340 11:57445686-57445708 CCAGGAGCAGTGGCTCATGCCTA No data
Right 1082805349 11:57445736-57445758 CAGGCATATTGCTTGAGTTCAGG No data
1082805340_1082805348 8 Left 1082805340 11:57445686-57445708 CCAGGAGCAGTGGCTCATGCCTA No data
Right 1082805348 11:57445717-57445739 GCATTTTGGGAGGCAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082805340 Original CRISPR TAGGCATGAGCCACTGCTCC TGG (reversed) Intergenic