ID: 1082805341

View in Genome Browser
Species Human (GRCh38)
Location 11:57445703-57445725
Sequence TGCCTACAATCCCAGCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082805336_1082805341 30 Left 1082805336 11:57445650-57445672 CCCAGTAGTTGTTTCATAAATTA No data
Right 1082805341 11:57445703-57445725 TGCCTACAATCCCAGCATTTTGG No data
1082805337_1082805341 29 Left 1082805337 11:57445651-57445673 CCAGTAGTTGTTTCATAAATTAT No data
Right 1082805341 11:57445703-57445725 TGCCTACAATCCCAGCATTTTGG No data
1082805340_1082805341 -6 Left 1082805340 11:57445686-57445708 CCAGGAGCAGTGGCTCATGCCTA No data
Right 1082805341 11:57445703-57445725 TGCCTACAATCCCAGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082805341 Original CRISPR TGCCTACAATCCCAGCATTT TGG Intergenic