ID: 1082805403

View in Genome Browser
Species Human (GRCh38)
Location 11:57446231-57446253
Sequence TCACACTCCTTGCCCAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082805400_1082805403 7 Left 1082805400 11:57446201-57446223 CCTGATGAGCCCAAGACAATCAT No data
Right 1082805403 11:57446231-57446253 TCACACTCCTTGCCCAAGACTGG No data
1082805402_1082805403 -3 Left 1082805402 11:57446211-57446233 CCAAGACAATCATGACAGTATCA No data
Right 1082805403 11:57446231-57446253 TCACACTCCTTGCCCAAGACTGG No data
1082805401_1082805403 -2 Left 1082805401 11:57446210-57446232 CCCAAGACAATCATGACAGTATC No data
Right 1082805403 11:57446231-57446253 TCACACTCCTTGCCCAAGACTGG No data
1082805399_1082805403 8 Left 1082805399 11:57446200-57446222 CCCTGATGAGCCCAAGACAATCA No data
Right 1082805403 11:57446231-57446253 TCACACTCCTTGCCCAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082805403 Original CRISPR TCACACTCCTTGCCCAAGAC TGG Intergenic
No off target data available for this crispr