ID: 1082807140

View in Genome Browser
Species Human (GRCh38)
Location 11:57458599-57458621
Sequence CGGCGGCGGGGAGGGAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082807140_1082807165 26 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807165 11:57458648-57458670 GCCCTAGTCGGGGTGGGTCCTGG No data
1082807140_1082807149 -2 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807149 11:57458620-57458642 CGCCTCCAGGCCCTCCCCCCAGG No data
1082807140_1082807169 28 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807169 11:57458650-57458672 CCTAGTCGGGGTGGGTCCTGGGG No data
1082807140_1082807162 16 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807162 11:57458638-57458660 CCAGGCGCAGGCCCTAGTCGGGG No data
1082807140_1082807152 4 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807140_1082807163 19 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807163 11:57458641-57458663 GGCGCAGGCCCTAGTCGGGGTGG No data
1082807140_1082807158 14 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807158 11:57458636-57458658 CCCCAGGCGCAGGCCCTAGTCGG No data
1082807140_1082807164 20 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807164 11:57458642-57458664 GCGCAGGCCCTAGTCGGGGTGGG No data
1082807140_1082807160 15 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807160 11:57458637-57458659 CCCAGGCGCAGGCCCTAGTCGGG No data
1082807140_1082807167 27 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807167 11:57458649-57458671 CCCTAGTCGGGGTGGGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082807140 Original CRISPR CGGCGGCGGGGAGGGAGTGT TGG (reversed) Intergenic
No off target data available for this crispr