ID: 1082807149

View in Genome Browser
Species Human (GRCh38)
Location 11:57458620-57458642
Sequence CGCCTCCAGGCCCTCCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082807140_1082807149 -2 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807149 11:57458620-57458642 CGCCTCCAGGCCCTCCCCCCAGG No data
1082807139_1082807149 -1 Left 1082807139 11:57458598-57458620 CCCAACACTCCCTCCCCGCCGCC No data
Right 1082807149 11:57458620-57458642 CGCCTCCAGGCCCTCCCCCCAGG No data
1082807136_1082807149 8 Left 1082807136 11:57458589-57458611 CCTGCTACCCCCAACACTCCCTC No data
Right 1082807149 11:57458620-57458642 CGCCTCCAGGCCCTCCCCCCAGG No data
1082807141_1082807149 -10 Left 1082807141 11:57458607-57458629 CCCTCCCCGCCGCCGCCTCCAGG No data
Right 1082807149 11:57458620-57458642 CGCCTCCAGGCCCTCCCCCCAGG No data
1082807135_1082807149 9 Left 1082807135 11:57458588-57458610 CCCTGCTACCCCCAACACTCCCT No data
Right 1082807149 11:57458620-57458642 CGCCTCCAGGCCCTCCCCCCAGG No data
1082807138_1082807149 0 Left 1082807138 11:57458597-57458619 CCCCAACACTCCCTCCCCGCCGC No data
Right 1082807149 11:57458620-57458642 CGCCTCCAGGCCCTCCCCCCAGG No data
1082807132_1082807149 14 Left 1082807132 11:57458583-57458605 CCCCACCCTGCTACCCCCAACAC No data
Right 1082807149 11:57458620-57458642 CGCCTCCAGGCCCTCCCCCCAGG No data
1082807134_1082807149 12 Left 1082807134 11:57458585-57458607 CCACCCTGCTACCCCCAACACTC No data
Right 1082807149 11:57458620-57458642 CGCCTCCAGGCCCTCCCCCCAGG No data
1082807137_1082807149 1 Left 1082807137 11:57458596-57458618 CCCCCAACACTCCCTCCCCGCCG No data
Right 1082807149 11:57458620-57458642 CGCCTCCAGGCCCTCCCCCCAGG No data
1082807131_1082807149 19 Left 1082807131 11:57458578-57458600 CCAAACCCCACCCTGCTACCCCC No data
Right 1082807149 11:57458620-57458642 CGCCTCCAGGCCCTCCCCCCAGG No data
1082807133_1082807149 13 Left 1082807133 11:57458584-57458606 CCCACCCTGCTACCCCCAACACT No data
Right 1082807149 11:57458620-57458642 CGCCTCCAGGCCCTCCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082807149 Original CRISPR CGCCTCCAGGCCCTCCCCCC AGG Intergenic
No off target data available for this crispr