ID: 1082807152

View in Genome Browser
Species Human (GRCh38)
Location 11:57458626-57458648
Sequence CAGGCCCTCCCCCCAGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082807133_1082807152 19 Left 1082807133 11:57458584-57458606 CCCACCCTGCTACCCCCAACACT No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807146_1082807152 -10 Left 1082807146 11:57458613-57458635 CCGCCGCCGCCTCCAGGCCCTCC No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807140_1082807152 4 Left 1082807140 11:57458599-57458621 CCAACACTCCCTCCCCGCCGCCG No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807138_1082807152 6 Left 1082807138 11:57458597-57458619 CCCCAACACTCCCTCCCCGCCGC No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807144_1082807152 -8 Left 1082807144 11:57458611-57458633 CCCCGCCGCCGCCTCCAGGCCCT No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807136_1082807152 14 Left 1082807136 11:57458589-57458611 CCTGCTACCCCCAACACTCCCTC No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807134_1082807152 18 Left 1082807134 11:57458585-57458607 CCACCCTGCTACCCCCAACACTC No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807135_1082807152 15 Left 1082807135 11:57458588-57458610 CCCTGCTACCCCCAACACTCCCT No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807137_1082807152 7 Left 1082807137 11:57458596-57458618 CCCCCAACACTCCCTCCCCGCCG No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807141_1082807152 -4 Left 1082807141 11:57458607-57458629 CCCTCCCCGCCGCCGCCTCCAGG No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807143_1082807152 -5 Left 1082807143 11:57458608-57458630 CCTCCCCGCCGCCGCCTCCAGGC No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807145_1082807152 -9 Left 1082807145 11:57458612-57458634 CCCGCCGCCGCCTCCAGGCCCTC No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807139_1082807152 5 Left 1082807139 11:57458598-57458620 CCCAACACTCCCTCCCCGCCGCC No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807132_1082807152 20 Left 1082807132 11:57458583-57458605 CCCCACCCTGCTACCCCCAACAC No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data
1082807131_1082807152 25 Left 1082807131 11:57458578-57458600 CCAAACCCCACCCTGCTACCCCC No data
Right 1082807152 11:57458626-57458648 CAGGCCCTCCCCCCAGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082807152 Original CRISPR CAGGCCCTCCCCCCAGGCGC AGG Intergenic
No off target data available for this crispr